Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI25321
Trapped Gene
Bcl2l1 (ENSMUSG00000007659)
Vector Insertion
Chr 2: 152655162 - 152655839
Public Clones not available
Private Clones OST187857 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000381992 (Chr2:152655163..152655838 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000381992 (Chr2:152655163..152655838 -)
Downstram Exon
ENSMUSE00000713045 (Chr2:152655163..152655838 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000556013 Chr2:152657339..152657464 No primer for this exon
upstream ENSMUSE00000681713 Chr2:152656122..152656402 No primer for this exon
upstream ENSMUSE00000381992 Chr2:152655163..152655838 No primer for this exon
upstream ENSMUSE00000713045 Chr2:152655163..152655838 No primer for this exon

*** Putative Vector Insertion (Chr 2: 152655162 - 152655839) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000681711 Chr2:152655023..152655034 No primer for this exon
downstream ENSMUSE00000556001 Chr2:152606408..152608018 No primer for this exon
downstream ENSMUSE00000595156 Chr2:152606404..152608018 No primer for this exon
downstream ENSMUSE00000556011 Chr2:152593052..152593195 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGGATCCTGGAAGAGAATCG Chr2:152655801..152655821 60.15 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGGATCCTGGAAGAGAATCG Chr2:152655801..152655821 60.15 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000007659