Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI25327
Trapped Gene
OTTMUSG00000022410 (ENSMUSG00000052439)
Vector Insertion
Chr 8: 74432638 - 74437020
Public Clones not available
Private Clones OST187687 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000682321 (Chr8:74432548..74432637 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000682321 (Chr8:74432548..74432637 +)
Downstram Exon
ENSMUSE00000581836 (Chr8:74437021..74437147 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon TCCTGAAGGTTTCCTGCATC Chr8:74437135..74437154 60.19 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000682326 Chr8:74432507..74432637 AACGCCATTGTCACTGCTCT Chr8:74432520..74432539 60.87 50
upstream ENSMUSE00000682321 Chr8:74432548..74432637 No primer for this exon

*** Putative Vector Insertion (Chr 8: 74432638 - 74437020) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000581836 Chr8:74437021..74437147 TCCTGAAGGTTTCCTGCATC Chr8:74437135..74437154 60.19 50
downstream ENSMUSE00000381255 Chr8:74437360..74437997 GACGAAGGCCACTGGAATAA Chr8:74437869..74437888 60.07 50
downstream ENSMUSE00000682325 Chr8:74437360..74440253 GAGAGCCCTGACGACTGAAC Chr8:74438280..74438299 59.99 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCCTCGGTACGGGAACTAAT Chr8:74432673..74432693 60.2 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TATCCGTGACTGGGAAAACC Chr8:74432685..74432705 59.79 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000052439