Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI25335
Trapped Gene
Zfp235 (ENSMUSG00000047603)
Vector Insertion
Chr 7: 24919507 - 24920276
Public Clones not available
Private Clones OST187430 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000676782 (Chr7:24919182..24919506 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGTTTCGGTGTGTCTTCTCG Chr7:24919281..24919300 59.87 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000676782 (Chr7:24919182..24919506 +)
Downstram Exon
ENSMUSE00000676781 (Chr7:24920277..24920334 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGTTTCGGTGTGTCTTCTCG Chr7:24919281..24919300 59.87 50 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000676782 Chr7:24919182..24919506 TGTTTCGGTGTGTCTTCTCG Chr7:24919281..24919300 59.87 50

*** Putative Vector Insertion (Chr 7: 24919507 - 24920276) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000676781 Chr7:24920277..24920334 No primer for this exon
downstream ENSMUSE00000536149 Chr7:24922065..24922191 CACTGAAGACTACGGCCACA Chr7:24922107..24922126 59.9 55
downstream ENSMUSE00000636619 Chr7:24923312..24923521 AAGAGGTCAGAGGTGCCAGA Chr7:24923383..24923402 59.99 55
downstream ENSMUSE00000393078 Chr7:24925319..24928258 CACCAGTAGCGCTTTCTTCC Chr7:24926033..24926052 60.01 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGGAACGGTGATGGCAGATA Chr7:24919465..24919485 60.48 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGGAACGGTGATGGCAGATA Chr7:24919465..24919485 60.48 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000047603