Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI25338
Trapped Gene
Tsn (ENSMUSG00000026374)
Vector Insertion
Chr 1: 120201893 - 120205321
Public Clones not available
Private Clones OST187387 (lexicon) OST63223 (lexicon)
Severity of mutation (?) Insertion after 38% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000158525 (Chr1:120205322..120205418 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGGTGCTTGAAAGCGAGAGA Chr1:120205391..120205410 60.28 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000158525 (Chr1:120205322..120205418 -)
Downstram Exon
ENSMUSE00000158528 (Chr1:120201777..120201892 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGGTGCTTGAAAGCGAGAGA Chr1:120205391..120205410 60.28 50 GTAACAGCCTCTCGGGTCAC Chr1:120201769..120201788 59.73 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000692745 Chr1:120207578..120207747 CTGTGAGCGAGATCTTCGTG Chr1:120207620..120207639 59.73 55
upstream ENSMUSE00000540365 Chr1:120206350..120206443 TACTTCAAGGGGTCCACCAG Chr1:120206369..120206388 59.96 55
upstream ENSMUSE00000158525 Chr1:120205322..120205418 AGGTGCTTGAAAGCGAGAGA Chr1:120205391..120205410 60.28 50

*** Putative Vector Insertion (Chr 1: 120201893 - 120205321) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000158528 Chr1:120201777..120201892 GTAACAGCCTCTCGGGTCAC Chr1:120201769..120201788 59.73 60
downstream ENSMUSE00000158524 Chr1:120201268..120201347 CTTTTTCCCGATCTGGTTCA Chr1:120201305..120201324 60.04 45
downstream ENSMUSE00000659655 Chr1:120194732..120197614 CAGCTCAGGCTTACCACTCC Chr1:120194822..120194841 60.01 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CGTCCCTGAAGACCAAGTTC Chr1:120202340..120202360 59.7 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATCTCACGTCCCTGAAGACC Chr1:120202346..120202366 59.1 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000026374