Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI25348
Trapped Gene
Gstt2 (ENSMUSG00000033318)
Vector Insertion
Chr 10: 75295314 - 75295405
Public Clones not available
Private Clones OST187184 (lexicon) OST91317 (lexicon)
Severity of mutation (?) Insertion after 48% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000224945 (Chr10:75295406..75295556 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTACCAGGTGGCAGACCACT Chr10:75295507..75295526 60.03 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000224945 (Chr10:75295406..75295556 -)
Downstram Exon
ENSMUSE00000224936 (Chr10:75295140..75295313 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTACCAGGTGGCAGACCACT Chr10:75295507..75295526 60.03 60 TCTCTGTTCCGTTCCACCTT Chr10:75295233..75295252 59.7 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000642542 Chr10:75296920..75297155 TGCTGTTATCGAACGCAGTC Chr10:75297060..75297079 60.02 50
upstream ENSMUSE00000224955 Chr10:75296397..75296484 GACGGAAGCTTCGTGTTGAC Chr10:75296403..75296422 60.84 55
upstream ENSMUSE00000224945 Chr10:75295406..75295556 GTACCAGGTGGCAGACCACT Chr10:75295507..75295526 60.03 60

*** Putative Vector Insertion (Chr 10: 75295314 - 75295405) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000224936 Chr10:75295140..75295313 TCTCTGTTCCGTTCCACCTT Chr10:75295233..75295252 59.7 50
downstream ENSMUSE00000642540 Chr10:75294594..75294839 ATGGTGCTATGAGCCTCCTG Chr10:75294705..75294724 60.24 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTTGGGCACCCAGTAAGAGT Chr10:75295353..75295373 59.21 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAGAGCGTGACTGGGAAAAC Chr10:75295339..75295359 59.33 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000033318