Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI25362
Trapped Gene
Hook3 (ENSMUSG00000037234)
Vector Insertion
Chr 8: 27145710 - 27148493
Public Clones not available
Private Clones OST186678 (lexicon)
Severity of mutation (?) Insertion after 86% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000251199 (Chr8:27148494..27148594 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCAAGAGGCTTTACGGAAGA Chr8:27148556..27148575 59.59 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000251199 (Chr8:27148494..27148594 -)
Downstram Exon
ENSMUSE00000251193 (Chr8:27145605..27145709 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCAAGAGGCTTTACGGAAGA Chr8:27148556..27148575 59.59 50 TTCTGGTGCTGCTCCTTGAT Chr8:27145640..27145659 60.94 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000477146 Chr8:27229430..27229642 CTGGTTGGTTGAAGGGAGAC Chr8:27229507..27229526 59.55 55
upstream ENSMUSE00000251091 Chr8:27221208..27221293 TTGTCATGTCCCAGGTTCTTC Chr8:27221215..27221235 59.96 47.62
upstream ENSMUSE00000449086 Chr8:27206230..27206302 TTCGACGATAATTGGCTAAACA Chr8:27206268..27206289 59.62 36.36
upstream ENSMUSE00000523228 Chr8:27204129..27204179 No primer for this exon
upstream ENSMUSE00000251159 Chr8:27198532..27198664 ATTTCACCCTTCCTGACGTG Chr8:27198623..27198642 59.97 50
upstream ENSMUSE00000251155 Chr8:27192986..27193053 GTCGTCATGACAGCCATTCA Chr8:27192990..27193009 60.7 50
upstream ENSMUSE00000251149 Chr8:27185340..27185402 GTCTCTGCTGGACATGATGC Chr8:27185362..27185381 59.38 55
upstream ENSMUSE00000251139 Chr8:27184072..27184155 TTGCTCAAAGATGCCATGAA Chr8:27184084..27184103 60.34 40
upstream ENSMUSE00000464055 Chr8:27182729..27182892 CAATAGCCCAGCAGGAAGAA Chr8:27182781..27182800 60.34 50
upstream ENSMUSE00000251242 Chr8:27181530..27181670 CAGCAGAACGATGAGCTGAC Chr8:27181581..27181600 59.73 55
upstream ENSMUSE00000251236 Chr8:27180546..27180747 GGCAGGTTAAGCTCTTGGAA Chr8:27180645..27180664 59.45 50
upstream ENSMUSE00000251230 Chr8:27179031..27179141 GCGGCTAAAAGAAAAAGTTGA Chr8:27179053..27179073 58.69 38.1
upstream ENSMUSE00000251223 Chr8:27178322..27178409 AAGAGTTGCGTTGTGTGCAG Chr8:27178350..27178369 60.1 50
upstream ENSMUSE00000251083 Chr8:27171849..27171918 AGCCTTGCAGCAGAGATTGT Chr8:27171864..27171883 60.16 50
upstream ENSMUSE00000251075 Chr8:27169712..27169852 TGCCTTATTGCAGAGCCTTC Chr8:27169758..27169777 60.49 50
upstream ENSMUSE00000251219 Chr8:27158724..27158811 TGCAGGATCAAGGTTCAAAA Chr8:27158733..27158752 59.25 40
upstream ENSMUSE00000251213 Chr8:27154712..27154746 No primer for this exon
upstream ENSMUSE00000251207 Chr8:27150141..27150223 GCCAACAATGAATTGCAGAA Chr8:27150188..27150207 59.67 40
upstream ENSMUSE00000251199 Chr8:27148494..27148594 GCAAGAGGCTTTACGGAAGA Chr8:27148556..27148575 59.59 50

*** Putative Vector Insertion (Chr 8: 27145710 - 27148493) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000251193 Chr8:27145605..27145709 TTCTGGTGCTGCTCCTTGAT Chr8:27145640..27145659 60.94 50
downstream ENSMUSE00000251184 Chr8:27145403..27145474 No primer for this exon
downstream ENSMUSE00000523227 Chr8:27139381..27142502 TGGTGACAGGTCCTCCCTAC Chr8:27139414..27139433 59.96 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000037234