Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI25378
Trapped Gene
Ptms (ENSMUSG00000030122)
Vector Insertion
Chr 6: 124864732 - 124864935
Public Clones not available
Private Clones OST186197 (lexicon)
Severity of mutation (?) Insertion after 38% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000195495 (Chr6:124864936..124865007 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CGGAAAGAACGGAAGAAAGA Chr6:124864946..124864965 59.42 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000195495 (Chr6:124864936..124865007 -)
Downstram Exon
ENSMUSE00000195494 (Chr6:124864653..124864731 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CGGAAAGAACGGAAGAAAGA Chr6:124864946..124864965 59.42 45 CATCCCCTTCATCATCATCC Chr6:124864637..124864656 60.1 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000651454 Chr6:124867578..124867964 No primer for this exon
upstream ENSMUSE00000718585 Chr6:124867578..124867964 No primer for this exon
upstream ENSMUSE00000195495 Chr6:124864936..124865007 CGGAAAGAACGGAAGAAAGA Chr6:124864946..124864965 59.42 45

*** Putative Vector Insertion (Chr 6: 124864732 - 124864935) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000195494 Chr6:124864653..124864731 CATCCCCTTCATCATCATCC Chr6:124864637..124864656 60.1 50
downstream ENSMUSE00000195499 Chr6:124864426..124864484 GCCTTCATCCTCCTCCTCTT Chr6:124864434..124864453 59.78 55
downstream ENSMUSE00000691709 Chr6:124864426..124864487 GCCTTCATCCTCCTCCTCTT Chr6:124864434..124864453 59.78 55
downstream ENSMUSE00000691708 Chr6:124863701..124864250 GAGGGAATCTGAGGGAGACC Chr6:124863789..124863808 60.01 60
downstream ENSMUSE00000651453 Chr6:124863699..124864250 GAGGGAATCTGAGGGAGACC Chr6:124863789..124863808 60.01 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGCCCAAACATCCTTCCTAA Chr6:124864881..124864901 60.44 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCGGAAAGAACGGAAGAAAG Chr6:124864945..124864965 61.08 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000030122