Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI25380
Trapped Gene
Rims2 (ENSMUSG00000037386)
Vector Insertion
Chr 15: 39107047 - 39123647
Public Clones IST10827C10 (tigm)
Private Clones OST186024 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000562092 (Chr15:39106960..39107046 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AATGAGAAGGAGCCCCAGAC Chr15:39107027..39107046 60.6 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000562092 (Chr15:39106960..39107046 +)
Downstram Exon
ENSMUSE00000474739 (Chr15:39123648..39123858 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AATGAGAAGGAGCCCCAGAC Chr15:39107027..39107046 60.6 55 CGAGCACAGAACTTGGTTTG Chr15:39123827..39123846 59.49 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000508133 Chr15:39029878..39030084 GCTGTCATGGATCGTCAGAA Chr15:39030032..39030051 59.79 50
upstream ENSMUSE00000562094 Chr15:39106522..39106554 ACACAAAGCACAACCGACAC Chr15:39106534..39106553 59.65 50
upstream ENSMUSE00000562092 Chr15:39106960..39107046 AATGAGAAGGAGCCCCAGAC Chr15:39107027..39107046 60.6 55

*** Putative Vector Insertion (Chr 15: 39107047 - 39123647) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000474739 Chr15:39123648..39123858 CGAGCACAGAACTTGGTTTG Chr15:39123827..39123846 59.49 50
downstream ENSMUSE00000473739 Chr15:39176856..39177166 TCTTGTTGTTTTCGGCACAA Chr15:39176896..39176915 60.27 40
downstream ENSMUSE00000683481 Chr15:39223668..39223789 TTGCATTGTTCAGCGTTTGT Chr15:39223791..39223810 60.3 40
downstream ENSMUSE00000460906 Chr15:39268543..39269468 CCATTGCAGCTCTACGTTCA Chr15:39269060..39269079 60.01 50
downstream ENSMUSE00000562027 Chr15:39283586..39283653 CTCACTGCTATGCCAAGACG Chr15:39283638..39283657 59.62 55
downstream ENSMUSE00000562090 Chr15:39283770..39283978 TGCTCCTCGTTAAGGGTTGT Chr15:39283965..39283984 59.73 50
downstream ENSMUSE00000562089 Chr15:39285906..39286025 CCAATTAGGCGATCTCCATC Chr15:39285955..39285974 59.49 50
downstream ENSMUSE00000562088 Chr15:39288224..39288323 AATGCACAAAGTCGACCTGA Chr15:39288270..39288289 59.29 45
downstream ENSMUSE00000562086 Chr15:39289310..39289433 CTTGCAATAGCCTCCCATTC Chr15:39289351..39289370 59.67 50
downstream ENSMUSE00000562084 Chr15:39291135..39291181 GTGCATGCGTGCTATCAGGT Chr15:39291172..39291191 62.24 55
downstream ENSMUSE00000562083 Chr15:39294044..39294156 CAGATAAGAACTGCGGGACA Chr15:39294148..39294167 58.87 50
downstream ENSMUSE00000562080 Chr15:39303880..39304010 TGGTGACCAACCTTGTCAAA Chr15:39303914..39303933 59.98 45
downstream ENSMUSE00000562078 Chr15:39307926..39308097 GGAATTCTCTTCGGTGGACA Chr15:39308026..39308045 60.05 50
downstream ENSMUSE00000562076 Chr15:39310103..39310256 AGTGCGGCTCATCATCTAGC Chr15:39310151..39310170 60.53 55
downstream ENSMUSE00000562075 Chr15:39338512..39338580 CATCCTCGCAGTCGTAGTCA Chr15:39338565..39338584 60.01 55
downstream ENSMUSE00000562072 Chr15:39341191..39341347 CACTAGGCGACCATGACCTT Chr15:39341334..39341353 60.13 55
downstream ENSMUSE00000562070 Chr15:39342810..39342920 CCATTCGGCTAATTGTGTTG Chr15:39342877..39342896 59.04 45
downstream ENSMUSE00000562026 Chr15:39366384..39366563 CTCGATAAGGCAGGTGAAGG Chr15:39366566..39366585 59.83 55
downstream ENSMUSE00000562069 Chr15:39367418..39367527 TCCTGTTCCCGGAGTACTTG Chr15:39367478..39367497 60.1 55
downstream ENSMUSE00000562045 Chr15:39398489..39398589 TCATTTGGCGATTTCTCTCC Chr15:39398527..39398546 60.15 45
downstream ENSMUSE00000562064 Chr15:39417136..39417308 TTGGACGGACATGTAGCTTG Chr15:39417279..39417298 59.72 50
downstream ENSMUSE00000562023 Chr15:39441610..39441687 GAACTGGTGTCTGTGCTCCA Chr15:39441656..39441675 59.87 55
downstream ENSMUSE00000562061 Chr15:39447815..39448056 GCGACTTTTCCGTGAGAGAC Chr15:39448034..39448053 60 55
downstream ENSMUSE00000683479 Chr15:39491331..39491472 GCCAGCTAGAGCCTCAAAAG Chr15:39491435..39491454 59.36 55
downstream ENSMUSE00000229123 Chr15:39506486..39506627 TAGCTGTTCATGCTGCCATC Chr15:39506615..39506634 59.98 50
downstream ENSMUSE00000229120 Chr15:39510794..39510906 AGGCCATCCAGGAAATCACT Chr15:39510859..39510878 60.85 50
downstream ENSMUSE00000229114 Chr15:39511176..39511277 CCGGATGATTTCTACCTCCA Chr15:39511237..39511256 59.89 50
downstream ENSMUSE00000229108 Chr15:39512535..39512674 GGCTATGCAGACTCCGTTGT Chr15:39512584..39512603 60.28 55
downstream ENSMUSE00000562051 Chr15:39513092..39513486 CAGAGACGATTGGGAAGCTC Chr15:39513277..39513296 59.95 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTCTAATCGCCTTGCAGCAC Chr15:39107095..39107115 61.44 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTCAGACGTGACTGGGAAAA Chr15:39107092..39107112 58.7 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000037386