Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI2539
Trapped Gene
Supt5h (ENSMUSG00000003435)
Vector Insertion
Chr 7: 29123455 - 29123713
Public Clones XS0525 (sanger)
Private Clones OST415862 (lexicon) OST285816 (lexicon) OST188737 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000597756 (Chr7:29123714..29123738 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000597756 (Chr7:29123714..29123738 -)
Downstram Exon
ENSMUSE00000255343 (Chr7:29123371..29123454 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000597756 Chr7:29123714..29123738 No primer for this exon

*** Putative Vector Insertion (Chr 7: 29123455 - 29123713) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000255343 Chr7:29123371..29123454 No primer for this exon
downstream ENSMUSE00000545908 Chr7:29116389..29116548 No primer for this exon
downstream ENSMUSE00000201071 Chr7:29115599..29115664 No primer for this exon
downstream ENSMUSE00000636037 Chr7:29115037..29115048 No primer for this exon
downstream ENSMUSE00000201047 Chr7:29114602..29114671 No primer for this exon
downstream ENSMUSE00000201049 Chr7:29114435..29114503 No primer for this exon
downstream ENSMUSE00000201061 Chr7:29114278..29114343 No primer for this exon
downstream ENSMUSE00000535353 Chr7:29114039..29114069 No primer for this exon
downstream ENSMUSE00000535352 Chr7:29113722..29113790 No primer for this exon
downstream ENSMUSE00000535350 Chr7:29110969..29111220 No primer for this exon
downstream ENSMUSE00000597754 Chr7:29108912..29109001 No primer for this exon
downstream ENSMUSE00000201057 Chr7:29108745..29108815 No primer for this exon
downstream ENSMUSE00000201069 Chr7:29107483..29107588 No primer for this exon
downstream ENSMUSE00000201056 Chr7:29107239..29107332 No primer for this exon
downstream ENSMUSE00000201066 Chr7:29107022..29107158 No primer for this exon
downstream ENSMUSE00000201052 Chr7:29105239..29105394 No primer for this exon
downstream ENSMUSE00000201058 Chr7:29104986..29105132 No primer for this exon
downstream ENSMUSE00000201051 Chr7:29103974..29104120 No primer for this exon
downstream ENSMUSE00000201060 Chr7:29103758..29103883 No primer for this exon
downstream ENSMUSE00000201067 Chr7:29102756..29102840 No primer for this exon
downstream ENSMUSE00000201048 Chr7:29102412..29102519 No primer for this exon
downstream ENSMUSE00000201070 Chr7:29102235..29102337 No primer for this exon
downstream ENSMUSE00000201064 Chr7:29102005..29102132 No primer for this exon
downstream ENSMUSE00000201062 Chr7:29101803..29101908 No primer for this exon
downstream ENSMUSE00000201074 Chr7:29101302..29101460 No primer for this exon
downstream ENSMUSE00000201050 Chr7:29101028..29101196 No primer for this exon
downstream ENSMUSE00000201068 Chr7:29100742..29100945 No primer for this exon
downstream ENSMUSE00000201059 Chr7:29100368..29100463 No primer for this exon
downstream ENSMUSE00000482763 Chr7:29099917..29100289 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTAATCGCCTTGCAGCACAT Chr7:29123643..29123663 61.2 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000003435