Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI25402
Trapped Gene
1700061G19Rik (ENSMUSG00000024209)
Vector Insertion
Chr 17: 57015104 - 57015510
Public Clones IST12526C1BBF1 (tigm) IST11852B1 (tigm) IST12257H5 (tigm) IST12012E1 (tigm)
IST10376H2 (tigm) IST10376H2 (tigm) IST12250A5 (tigm) IST12066B3 (tigm)
IST12012E1 (tigm) IST12250A5 (tigm) IST12257H5 (tigm) IST12066B3 (tigm)
IST10376H11 (tigm) IST12526C1 (tigm)
Private Clones OST185345 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000284015 (Chr17:57014906..57015103 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGATAAAGTGGCAGCCTGTG Chr17:57015009..57015028 59.86 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000284015 (Chr17:57014906..57015103 +)
Downstram Exon
ENSMUSE00000283990 (Chr17:57015511..57015819 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGATAAAGTGGCAGCCTGTG Chr17:57015009..57015028 59.86 50 GAGGACCAGGTGTCCACAGT Chr17:57015632..57015651 60.01 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000284015 Chr17:57014906..57015103 TGATAAAGTGGCAGCCTGTG Chr17:57015009..57015028 59.86 50

*** Putative Vector Insertion (Chr 17: 57015104 - 57015510) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000283990 Chr17:57015511..57015819 GAGGACCAGGTGTCCACAGT Chr17:57015632..57015651 60.01 60
downstream ENSMUSE00000283969 Chr17:57016786..57017012 TGGCCTTCTCGCTTAGATGT Chr17:57016822..57016841 59.98 50
downstream ENSMUSE00000376498 Chr17:57019874..57019962 ACCATGAAAGCGTTCCAGAC Chr17:57019900..57019919 60.12 50
downstream ENSMUSE00000283885 Chr17:57020369..57020489 AGGTCTCAGCGATGACTTGG Chr17:57020436..57020455 60.41 55
downstream ENSMUSE00000493939 Chr17:57021590..57021670 ATGCTTCAAGTAGCCCTGGA Chr17:57021613..57021632 59.84 50
downstream ENSMUSE00000283830 Chr17:57021964..57022113 TGATTGGGCTTCAGTGTGTC Chr17:57022046..57022065 59.68 50
downstream ENSMUSE00000139757 Chr17:57022203..57022409 GAAGCAAAGTGGCAGGTAGC Chr17:57022301..57022320 60.02 55
downstream ENSMUSE00000139751 Chr17:57022739..57022920 CAGCTTCTTGTTGGTGTGGA Chr17:57022915..57022934 59.87 50
downstream ENSMUSE00000283755 Chr17:57023050..57023283 ACTCCGACAAGCCGTACAAC Chr17:57023237..57023256 60.18 55
downstream ENSMUSE00000139749 Chr17:57024174..57024391 CCACCTTCCTCTCTGTGCTC Chr17:57024313..57024332 59.99 60
downstream ENSMUSE00000139761 Chr17:57024507..57024646 GGGATACGGGTTGACCATTT Chr17:57024553..57024572 60.81 50
downstream ENSMUSE00000283440 Chr17:57025864..57026110 AGGTTACTCCGAGCCTCTCC Chr17:57025907..57025926 59.84 60
downstream ENSMUSE00000693744 Chr17:57028060..57028327 GGCGCTTGAACGAAGATTAG Chr17:57028182..57028201 59.98 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCCACTAGGCACAGAAGGTC Chr17:57015088..57015108 59.87 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCCACTAGGCACAGAAGGTC Chr17:57015088..57015108 59.87 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000024209