Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI25405
Trapped Gene
Spg11 (ENSMUSG00000033396)
Vector Insertion
Chr 2: 121938976 - 121940343
Public Clones not available
Private Clones OST185298 (lexicon) OST183413 (lexicon)
Severity of mutation (?) Insertion after 6% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000400361 (Chr2:121940344..121940525 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGACGCAGCCTTATTACACG Chr2:121940392..121940411 59.9 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000400361 (Chr2:121940344..121940525 -)
Downstram Exon
ENSMUSE00000349429 (Chr2:121938751..121938975 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGACGCAGCCTTATTACACG Chr2:121940392..121940411 59.9 50 ACACAACGCGTAGGATGAGA Chr2:121938864..121938883 59.32 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000560648 Chr2:121943857..121944122 GGCAGTCTCCAAGTGCTTTC Chr2:121943914..121943933 60 55
upstream ENSMUSE00000400361 Chr2:121940344..121940525 TGACGCAGCCTTATTACACG Chr2:121940392..121940411 59.9 50

*** Putative Vector Insertion (Chr 2: 121938976 - 121940343) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000349429 Chr2:121938751..121938975 ACACAACGCGTAGGATGAGA Chr2:121938864..121938883 59.32 50
downstream ENSMUSE00000387312 Chr2:121937452..121937644 GCGTGCCATCCATAGTGTTA Chr2:121937596..121937615 59.57 50
downstream ENSMUSE00000360246 Chr2:121934429..121934566 AGTAGGTGTCCCGGATGTTG Chr2:121934524..121934543 59.84 55
downstream ENSMUSE00000403324 Chr2:121933773..121934221 ACGTGCTCCTTCTGAGGAAA Chr2:121933996..121934015 59.99 50
downstream ENSMUSE00000597448 Chr2:121929644..121929789 TGCCGTGGATCATTAGTCTG Chr2:121929696..121929715 59.67 50
downstream ENSMUSE00000597447 Chr2:121927382..121927514 ATGGGATGAAAAGGGATGCT Chr2:121927373..121927392 60.66 45
downstream ENSMUSE00000597446 Chr2:121923837..121923992 TTTGGGTTTCCGAGTCACTT Chr2:121923899..121923918 59.57 45
downstream ENSMUSE00000597445 Chr2:121922992..121923167 TCAAAATGGCCACTCCTTTC Chr2:121923107..121923126 60.05 45
downstream ENSMUSE00000597444 Chr2:121921326..121921502 AGGCCGATCCTAACCAGTTC Chr2:121921371..121921390 60.46 55
downstream ENSMUSE00000383109 Chr2:121920194..121920265 No primer for this exon
downstream ENSMUSE00000443378 Chr2:121919152..121919279 GCATTTTCCTGGAAGTGTCC Chr2:121919151..121919170 59.53 50
downstream ENSMUSE00000443910 Chr2:121918701..121918876 GGACTTAGTCTGCGGAGAAGG Chr2:121918684..121918704 60.39 57.14
downstream ENSMUSE00000514769 Chr2:121917893..121918103 CTGCTGAGGTGACTCGGTTT Chr2:121917963..121917982 60.44 55
downstream ENSMUSE00000517550 Chr2:121913869..121914072 ACCGGGAATGAAAGTCACAC Chr2:121913911..121913930 59.83 50
downstream ENSMUSE00000516093 Chr2:121912599..121912705 AGACTTGCCGACATTGAACC Chr2:121912592..121912611 60.12 50
downstream ENSMUSE00000518857 Chr2:121910631..121910776 AGGGTGTGTCCTTCCAACAG Chr2:121910655..121910674 60 55
downstream ENSMUSE00000477496 Chr2:121909136..121909297 GTAGCTGGGGGTCCACTTTC Chr2:121909221..121909240 60.88 60
downstream ENSMUSE00000480385 Chr2:121907591..121907657 No primer for this exon
downstream ENSMUSE00000479769 Chr2:121905969..121906134 GGAAAAGTGTGGGAGCTGAC Chr2:121906084..121906103 59.7 55
downstream ENSMUSE00000482625 Chr2:121901031..121901236 GCTTGGAGCCCAAAATTACA Chr2:121901054..121901073 60.07 45
downstream ENSMUSE00000481554 Chr2:121900240..121900348 TCACCGTCAGCAAGCTTAGA Chr2:121900296..121900315 59.74 50
downstream ENSMUSE00000444002 Chr2:121898582..121898741 GGTAGGACACGCTCAGCTTC Chr2:121898637..121898656 60.02 60
downstream ENSMUSE00000443982 Chr2:121897791..121898045 AGCTCCAAGAGGTGGACTCA Chr2:121897834..121897853 59.99 55
downstream ENSMUSE00000443976 Chr2:121896601..121896801 AACCTCGGATGAGAGTGTGG Chr2:121896596..121896615 60.11 55
downstream ENSMUSE00000443971 Chr2:121895605..121895712 No primer for this exon
downstream ENSMUSE00000443964 Chr2:121894475..121894637 CCAGCTCATACTGCGTCTCA Chr2:121894501..121894520 60.16 55
downstream ENSMUSE00000443961 Chr2:121891981..121892195 AATGACTGCAGGGCTAATGG Chr2:121892097..121892116 60.1 50
downstream ENSMUSE00000291922 Chr2:121890645..121891392 CGGCAGATCCAAATCTGTTT Chr2:121891078..121891097 60.07 45
downstream ENSMUSE00000402261 Chr2:121886658..121886797 GTGGAGGTTCTGGGCTACCT Chr2:121886708..121886727 60.51 60
downstream ENSMUSE00000291912 Chr2:121885907..121886105 CAGCCACTAGTTCAGCCACA Chr2:121885927..121885946 60.05 55
downstream ENSMUSE00000291909 Chr2:121885436..121885573 TTCCTCTGCTGGGTTGAAAG Chr2:121885520..121885539 60.37 50
downstream ENSMUSE00000291905 Chr2:121885158..121885291 TGTGGCACGTGAAGGTAAAG Chr2:121885219..121885238 59.76 50
downstream ENSMUSE00000167238 Chr2:121884079..121884186 TGCTTTTGATGCAGCAAGTC Chr2:121884094..121884113 60.14 45
downstream ENSMUSE00000167247 Chr2:121881802..121881970 TCAGCTTCAGTTGGATGCAG Chr2:121881798..121881817 60.14 50
downstream ENSMUSE00000443941 Chr2:121881433..121881521 TTAGTTGGGCTCCATCCTTG Chr2:121881470..121881489 60.07 50
downstream ENSMUSE00000443934 Chr2:121881102..121881257 ACTTGGTGAGCCGGTTACAG Chr2:121881190..121881209 60.17 55
downstream ENSMUSE00000244633 Chr2:121880116..121880267 GCCCAGTCAGGAACAAAGTC Chr2:121880202..121880221 59.7 55
downstream ENSMUSE00000625487 Chr2:121879531..121879796 GTCGGTAGGCTGGTGTTGTT Chr2:121879750..121879769 60.03 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAGGACACTGCAGAAGCTCA Chr2:121940360..121940380 59.29 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAGGACACTGCAGAAGCTCA Chr2:121940360..121940380 59.29 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000033396