Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI25410
Trapped Gene
Cox5a (ENSMUSG00000000088)
Vector Insertion
Chr 9: 57379600 - 57380088
Public Clones not available
Private Clones OST184882 (lexicon)
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000259720 (Chr9:57379476..57379599 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000259720 (Chr9:57379476..57379599 +)
Downstram Exon
ENSMUSE00000378803 (Chr9:57380089..57380230 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000394700 Chr9:57369105..57369222 No primer for this exon
upstream ENSMUSE00000259754 Chr9:57376763..57376879 No primer for this exon
upstream ENSMUSE00000218559 Chr9:57378048..57378169 No primer for this exon
upstream ENSMUSE00000259720 Chr9:57379476..57379599 No primer for this exon

*** Putative Vector Insertion (Chr 9: 57379600 - 57380088) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000378803 Chr9:57380089..57380230 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGGGCCTTGACAAAGTGTAA Chr9:57379571..57379591 59.17 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGGGCCTTGACAAAGTGTAA Chr9:57379571..57379591 59.17 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000000088