Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI25414
Trapped Gene
Ebp (ENSMUSG00000031168)
Vector Insertion
Chr X: 7764046 - 7767204
Public Clones (sanger) CMHD-GT_98A5-3 (cmhd) IST11328H11 (tigm) IST10824B1 (tigm)
IST10824B1 (tigm) IST11328H11 (tigm)
Private Clones OST184742 (lexicon) OST47803 (lexicon)
Severity of mutation (?) Insertion after 43% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000207021 (ChrX:7767205..7767562 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACTTCGCATATCCTGGTTGG ChrX:7767405..7767424 59.96 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000207021 (ChrX:7767205..7767562 -)
Downstram Exon
ENSMUSE00000207022 (ChrX:7764009..7764045 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACTTCGCATATCCTGGTTGG ChrX:7767405..7767424 59.96 50 TATCGGCTATCTCCCTTGGA ChrX:7763993..7764012 59.62 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000207019 ChrX:7769927..7770006 AGTCGCAAGCCTGTGTTAGG ChrX:7769955..7769974 60.45 55
upstream ENSMUSE00000207021 ChrX:7767205..7767562 ACTTCGCATATCCTGGTTGG ChrX:7767405..7767424 59.96 50

*** Putative Vector Insertion (Chr X: 7764046 - 7767204) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000207022 ChrX:7764009..7764045 TATCGGCTATCTCCCTTGGA ChrX:7763993..7764012 59.62 50
downstream ENSMUSE00000207018 ChrX:7763770..7763900 CTGTAGGACAAAGCGGAAGG ChrX:7763764..7763783 59.87 55
downstream ENSMUSE00000400606 ChrX:7762461..7762959 GCTGGAGTCCTTCGTGTAGC ChrX:7762881..7762900 60.02 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGGAGGGAATTTTCTGGGTA ChrX:7764159..7764179 60.12 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGGAGGGAATTTTCTGGGTA ChrX:7764159..7764179 60.12 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 CCAATTATAATCGCCTTGCAG ChrX:7764498..7764519 59.6 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 CACCACGTGCTTTCTGTTTG ChrX:7767566..7767586 60.34 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031168