Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI25417
Trapped Gene
Myo1b (ENSMUSG00000018417)
Vector Insertion
Chr 1: 51891388 - 51920162
Public Clones not available
Private Clones OST184540 (lexicon)
Severity of mutation (?) Insertion after 8% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000301440 (Chr1:51920163..51920278 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000301440 (Chr1:51920163..51920278 -)
Downstram Exon
ENSMUSE00000301433 (Chr1:51891293..51891387 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000602615 Chr1:51972605..51972796 No primer for this exon
upstream ENSMUSE00000699763 Chr1:51963975..51964160 No primer for this exon
upstream ENSMUSE00000301447 Chr1:51939927..51940070 No primer for this exon
upstream ENSMUSE00000699762 Chr1:51939927..51940070 No primer for this exon
upstream ENSMUSE00000301440 Chr1:51920163..51920278 No primer for this exon

*** Putative Vector Insertion (Chr 1: 51891388 - 51920162) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000301433 Chr1:51891293..51891387 No primer for this exon
downstream ENSMUSE00000301429 Chr1:51880941..51881045 No primer for this exon
downstream ENSMUSE00000155814 Chr1:51876985..51877031 No primer for this exon
downstream ENSMUSE00000155812 Chr1:51869847..51869910 No primer for this exon
downstream ENSMUSE00000155832 Chr1:51858028..51858126 No primer for this exon
downstream ENSMUSE00000155835 Chr1:51856376..51856479 No primer for this exon
downstream ENSMUSE00000155813 Chr1:51854232..51854379 No primer for this exon
downstream ENSMUSE00000155820 Chr1:51853843..51853961 No primer for this exon
downstream ENSMUSE00000155821 Chr1:51851156..51851242 No primer for this exon
downstream ENSMUSE00000155825 Chr1:51850484..51850549 No primer for this exon
downstream ENSMUSE00000301369 Chr1:51841281..51841385 No primer for this exon
downstream ENSMUSE00000155818 Chr1:51838814..51838876 No primer for this exon
downstream ENSMUSE00000155811 Chr1:51836405..51836605 No primer for this exon
downstream ENSMUSE00000155816 Chr1:51835165..51835391 No primer for this exon
downstream ENSMUSE00000155824 Chr1:51833048..51833248 No primer for this exon
downstream ENSMUSE00000301331 Chr1:51831156..51831249 No primer for this exon
downstream ENSMUSE00000155819 Chr1:51830077..51830226 No primer for this exon
downstream ENSMUSE00000155829 Chr1:51827630..51827698 No primer for this exon
downstream ENSMUSE00000155833 Chr1:51825848..51825934 No primer for this exon
downstream ENSMUSE00000630020 Chr1:51825494..51825580 No primer for this exon
downstream ENSMUSE00000630026 Chr1:51823666..51823752 No primer for this exon
downstream ENSMUSE00000155834 Chr1:51820734..51820808 No primer for this exon
downstream ENSMUSE00000155831 Chr1:51819336..51819470 No primer for this exon
downstream ENSMUSE00000155830 Chr1:51817139..51817245 No primer for this exon
downstream ENSMUSE00000155827 Chr1:51814720..51814852 No primer for this exon
downstream ENSMUSE00000155826 Chr1:51813949..51814101 No primer for this exon
downstream ENSMUSE00000155815 Chr1:51812487..51812614 No primer for this exon
downstream ENSMUSE00000413074 Chr1:51806833..51808140 No primer for this exon
downstream ENSMUSE00000602616 Chr1:51806609..51808140 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAACGATAATCGCCTTGCAG Chr1:51896097..51896117 60.74 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCTGCATGAAGGTCACAGAG Chr1:51896181..51896201 59.42 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000018417