Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI2542
Trapped Gene
Ndufb6 (ENSMUSG00000071014)
Vector Insertion
Chr 4: 40224779 - 40226190
Public Clones XS0504 (sanger) CMHD-GT_390G9-3 (cmhd)
Private Clones not available
Severity of mutation (?) Insertion after 62% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000605103 (Chr4:40226191..40226401 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGGAGCGATTCTGGGATAAC Chr4:40226224..40226243 60.04 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000605103 (Chr4:40226191..40226401 -)
Downstram Exon
ENSMUSE00000605102 (Chr4:40224686..40224778 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGGAGCGATTCTGGGATAAC Chr4:40226224..40226243 60.04 50 GAAGAGACTGGAGCGGTACG Chr4:40224727..40224746 60.01 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000605103 Chr4:40226191..40226401 TGGAGCGATTCTGGGATAAC Chr4:40226224..40226243 60.04 50

*** Putative Vector Insertion (Chr 4: 40224779 - 40226190) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000605102 Chr4:40224686..40224778 GAAGAGACTGGAGCGGTACG Chr4:40224727..40224746 60.01 60
downstream ENSMUSE00000633016 Chr4:40219843..40219887 CTGGGCTTCGAGCTAACAAT Chr4:40219831..40219850 59.48 50
downstream ENSMUSE00000605101 Chr4:40217696..40217880 GGAAAATCTCTCATTGGTGGA Chr4:40217806..40217826 58.97 42.86

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATGGTGAGTGATGAGCCACA Chr4:40226172..40226192 60.12 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATGGTGAGTGATGAGCCACA Chr4:40226172..40226192 60.12 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000071014