Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI25435
Trapped Gene
Zmiz1 (ENSMUSG00000007817)
Vector Insertion
Chr 14: 26401160 - 26455358
Public Clones IST14782C11 (tigm) IST12920D9 (tigm) IST10228D10 (tigm) IST11025E8 (tigm)
IST10010B5 (tigm) IST14873F3 (tigm) IST11433B8 (tigm) IST15104D2 (tigm)
IST14794G11 (tigm) IST11076D9 (tigm) IST14715E12 (tigm) IST13074H1 (tigm)
IST10813A12 (tigm) IST12393C6 (tigm) IST11096F6 (tigm) IST12689E6 (tigm)
IST10036G11 (tigm) IST10758A8 (tigm) IST14329A4 (tigm) IST12524A1 (tigm)
IST14729G4 (tigm) IST12131G3 (tigm) IST12563F2 (tigm) IST11084F7 (tigm)
IST11518G11 (tigm) IST10070E10 (tigm) IST14378D6 (tigm) IST14921D12 (tigm)
IST14822D9 (tigm) IST14949D3 (tigm) IST14559C12 (tigm) IST14946H6 (tigm)
IST11028A3 (tigm) IST10487E3 (tigm) IST13851H12 (tigm) IST12482E7 (tigm)
IST14983C12 (tigm) IST10579E10 (tigm) IST14822D9 (tigm) IST10907A1 (tigm)
IST10996G8 (tigm) IST11747H6 (tigm) IST14609C12 (tigm) IST11025E8 (tigm)
IST10936H2 (tigm) IST11084F7 (tigm) IST10228D10 (tigm) IST11534H9 (tigm)
IST10115E7 (tigm) IST15087E8 (tigm) IST14285H11 (tigm) IST12083C5 (tigm)
IST10034F10 (tigm) IST14921D12 (tigm) IST14946G10 (tigm) IST11252F11 (tigm)
IST12393C6 (tigm) IST10354B3 (tigm) IST14822E8 (tigm) IST14806C2 (tigm)
IST10077B9 (tigm) IST15087E8 (tigm)
Private Clones OST183973 (lexicon)
Severity of mutation (?) Insertion after 9% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000356831 (Chr14:26401054..26401159 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000356831 (Chr14:26401054..26401159 +)
Downstram Exon
ENSMUSE00000401270 (Chr14:26455359..26455503 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000520785 Chr14:26278778..26279042 No primer for this exon
upstream ENSMUSE00000512608 Chr14:26322141..26322245 No primer for this exon
upstream ENSMUSE00000515451 Chr14:26356231..26356310 No primer for this exon
upstream ENSMUSE00000373676 Chr14:26391506..26391614 No primer for this exon
upstream ENSMUSE00000345881 Chr14:26395617..26395730 No primer for this exon
upstream ENSMUSE00000356831 Chr14:26401054..26401159 No primer for this exon

*** Putative Vector Insertion (Chr 14: 26401160 - 26455358) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000401270 Chr14:26455359..26455503 No primer for this exon
downstream ENSMUSE00000254838 Chr14:26463044..26463158 No primer for this exon
downstream ENSMUSE00000254829 Chr14:26464142..26464359 No primer for this exon
downstream ENSMUSE00000378532 Chr14:26465145..26465343 No primer for this exon
downstream ENSMUSE00000430683 Chr14:26466203..26466493 No primer for this exon
downstream ENSMUSE00000254790 Chr14:26469154..26469336 No primer for this exon
downstream ENSMUSE00000501224 Chr14:26470011..26470091 No primer for this exon
downstream ENSMUSE00000121450 Chr14:26470705..26470879 No primer for this exon
downstream ENSMUSE00000121466 Chr14:26471333..26471474 No primer for this exon
downstream ENSMUSE00000563707 Chr14:26472809..26473019 No primer for this exon
downstream ENSMUSE00000563705 Chr14:26473985..26474090 No primer for this exon
downstream ENSMUSE00000121470 Chr14:26474583..26474743 No primer for this exon
downstream ENSMUSE00000563704 Chr14:26475509..26475576 No primer for this exon
downstream ENSMUSE00000121455 Chr14:26475810..26475878 No primer for this exon
downstream ENSMUSE00000121457 Chr14:26476232..26476476 No primer for this exon
downstream ENSMUSE00000121461 Chr14:26477593..26477759 No primer for this exon
downstream ENSMUSE00000254734 Chr14:26480753..26481007 No primer for this exon
downstream ENSMUSE00000401797 Chr14:26482426..26484193 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAGAGGCTTTCGTGCTTGGA Chr14:26407186..26407206 61.04 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCTTCGTGACTGGGAAAACC Chr14:26410207..26410227 60.09 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000007817