Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI2544
Trapped Gene
AC160147.6 (ENSMUSG00000061983)
Vector Insertion
Chr 10: 23505381 - 23505811
Public Clones XS0491 (sanger)
Private Clones OST376219 (lexicon) OST350065 (lexicon)
Severity of mutation (?) Insertion after 60% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000469732 (Chr10:23505708..23505810 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGAGCCCATGTATGTCAAGC Chr10:23505752..23505771 59.68 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000469732 (Chr10:23505708..23505810 -)
Downstram Exon
ENSMUSE00000510690 (Chr10:23505382..23505483 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGAGCCCATGTATGTCAAGC Chr10:23505752..23505771 59.68 50 TGCCCTCTCGATCGATTTTA Chr10:23505401..23505420 60.68 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000416964 Chr10:23506962..23507005 No primer for this exon
upstream ENSMUSE00000461522 Chr10:23506800..23506850 No primer for this exon
upstream ENSMUSE00000467687 Chr10:23506570..23506686 AGCTGCTGGAGGTGTAATGG Chr10:23506664..23506683 60.28 55
upstream ENSMUSE00000469732 Chr10:23505708..23505810 TGAGCCCATGTATGTCAAGC Chr10:23505752..23505771 59.68 50
upstream ENSMUSE00000510690 Chr10:23505382..23505483 TTGGTTGCAGTTGCGTAGTG Chr10:23505388..23505407 60.9 50

*** Putative Vector Insertion (Chr 10: 23505381 - 23505811) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000409210 Chr10:23505003..23505079 GATGACATCCTTGGCCTGAG Chr10:23505022..23505041 60.62 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGCACAGTGAAGACCCTTGAA Chr10:23505837..23505858 59.9 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGCACAGTGAAGACCCTTGAA Chr10:23505837..23505858 59.9 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GCTGAGCACCAAATCAACCT Chr10:23505713..23505733 60.26 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GCTGAGCACCAAATCAACCT Chr10:23505713..23505733 60.26 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000061983