Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI2547
Trapped Gene
Cisd2 (ENSMUSG00000028165)
Vector Insertion
Chr 3: 135071855 - 135072975
Public Clones XS0445 (sanger) CMHD-GT_414C6-3 (cmhd) IST12334F3 (tigm)
Private Clones OST453598 (lexicon) OST394766 (lexicon) OST303714 (lexicon) OST251983 (lexicon)
OST203966 (lexicon) OST65310 (lexicon)
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000713419 (Chr3:135072976..135074189 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TTGCTTGATCGTGCCTGTAG Chr3:135073764..135073783 60.01 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000713419 (Chr3:135072976..135074189 -)
Downstram Exon
ENSMUSE00000341386 (Chr3:135069378..135071854 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TTGCTTGATCGTGCCTGTAG Chr3:135073764..135073783 60.01 50 CAGGCAGACAGGCACTCATA Chr3:135069902..135069921 60.01 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000410038 Chr3:135086223..135086889 CCACAAGACAAGCGTGGTTA Chr3:135086785..135086804 59.76 50
upstream ENSMUSE00000714064 Chr3:135086223..135086371 No primer for this exon
upstream ENSMUSE00000176946 Chr3:135073975..135074189 CCCAAGGTGGTGAATGAGAT Chr3:135074036..135074055 59.78 50
upstream ENSMUSE00000713419 Chr3:135072976..135074189 TTGCTTGATCGTGCCTGTAG Chr3:135073764..135073783 60.01 50

*** Putative Vector Insertion (Chr 3: 135071855 - 135072975) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000341386 Chr3:135069378..135071854 CAGGCAGACAGGCACTCATA Chr3:135069902..135069921 60.01 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATTGGGAAGTCAACAGAAATCA Chr3:135072999..135073021 58.55 36.36 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATTGGGAAGTCAACAGAAATCA Chr3:135072999..135073021 58.55 36.36 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 CTTCCAGGAGAGTCGTGCAT Chr3:135074211..135074231 60.41 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 CTTCCAGGAGAGTCGTGCAT Chr3:135074211..135074231 60.41 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000028165