Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI25476
Trapped Gene
CT025653.7-201 (ENSMUSG00000047412)
Vector Insertion
Chr 9: 30871928 - 30874243
Public Clones not available
Private Clones OST182507 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000413910 (Chr9:30871764..30871927 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAGACCGTTTCAGTGTCCAA Chr9:30871848..30871867 59.72 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000413910 (Chr9:30871764..30871927 +)
Downstram Exon
ENSMUSE00000702093 (Chr9:30874244..30874327 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAGACCGTTTCAGTGTCCAA Chr9:30871848..30871867 59.72 50 TTTAGCGAGTAAGCCCTGGT Chr9:30874307..30874326 59 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000702098 Chr9:30838229..30838543 AAGAGGAGGAGCAGTTGCAG Chr9:30838494..30838513 59.74 55
upstream ENSMUSE00000424081 Chr9:30860825..30861898 AGGCAGAAAATACCCGGACT Chr9:30861620..30861639 59.96 50
upstream ENSMUSE00000450794 Chr9:30869626..30869710 TCATGCAGATGACGATGACA Chr9:30869690..30869709 59.78 45
upstream ENSMUSE00000413910 Chr9:30871764..30871927 CAGACCGTTTCAGTGTCCAA Chr9:30871848..30871867 59.72 50
upstream ENSMUSE00000702097 Chr9:30871818..30871927 CAGACCGTTTCAGTGTCCAA Chr9:30871848..30871867 59.72 50

*** Putative Vector Insertion (Chr 9: 30871928 - 30874243) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000702093 Chr9:30874244..30874327 TTTAGCGAGTAAGCCCTGGT Chr9:30874307..30874326 59 50
downstream ENSMUSE00000363120 Chr9:30874339..30874544 TACTCCCCGAAGGAAGTGAA Chr9:30874388..30874407 59.67 50
downstream ENSMUSE00000702088 Chr9:30874753..30874760 No primer for this exon
downstream ENSMUSE00000638059 Chr9:30876330..30877844 GGGGAAAAGTGCTTTCACAA Chr9:30876487..30876506 60.09 45
downstream ENSMUSE00000702091 Chr9:30876330..30877844 GGGGAAAAGTGCTTTCACAA Chr9:30876487..30876506 60.09 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000047412