Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI25478
Trapped Gene
Frmd5 (ENSMUSG00000027238)
Vector Insertion
Chr 2: 121412164 - 121412208
Public Clones not available
Private Clones OST182391 (lexicon) OST23305 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000426073 (Chr2:121412165..121412207 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAGTGGTGAAGCAGCTGAGA Chr2:121412166..121412185 60.33 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000426073 (Chr2:121412165..121412207 -)
Downstram Exon
ENSMUSE00000684539 (Chr2:121412165..121412207 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAGTGGTGAAGCAGCTGAGA Chr2:121412166..121412185 60.33 55 CAGCTGCTTCACCACTGACT Chr2:121412147..121412166 59.21 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000480909 Chr2:121632466..121632567 AGCGAGTACACCTGCACCAT Chr2:121632470..121632489 60.74 55
upstream ENSMUSE00000684499 Chr2:121632466..121632728 AGCGAGTACACCTGCACCAT Chr2:121632470..121632489 60.74 55
upstream ENSMUSE00000721070 Chr2:121612998..121613080 CCAGAGACAGCTTCCTCGTC Chr2:121613002..121613021 60.13 60
upstream ENSMUSE00000684543 Chr2:121590767..121590820 GCCTGAAGGAAAGCCATAGA Chr2:121590779..121590798 59.41 50
upstream ENSMUSE00000427046 Chr2:121417394..121417498 CTTTGGGATTCGTTTTGTGG Chr2:121417411..121417430 60.34 45
upstream ENSMUSE00000684541 Chr2:121417394..121417498 CTTTGGGATTCGTTTTGTGG Chr2:121417411..121417430 60.34 45
upstream ENSMUSE00000426073 Chr2:121412165..121412207 CAGTGGTGAAGCAGCTGAGA Chr2:121412166..121412185 60.33 55
upstream ENSMUSE00000684539 Chr2:121412165..121412207 CAGTGGTGAAGCAGCTGAGA Chr2:121412166..121412185 60.33 55

*** Putative Vector Insertion (Chr 2: 121412164 - 121412208) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000427062 Chr2:121411642..121411720 GGTCGGCAGGGTAAAACTTC Chr2:121411648..121411667 60.86 55
downstream ENSMUSE00000684538 Chr2:121411642..121411720 GGTCGGCAGGGTAAAACTTC Chr2:121411648..121411667 60.86 55
downstream ENSMUSE00000715077 Chr2:121411642..121411720 GGTCGGCAGGGTAAAACTTC Chr2:121411648..121411667 60.86 55
downstream ENSMUSE00000292220 Chr2:121402058..121402155 GCCGTGGTAGAGATCCCTTT Chr2:121402091..121402110 60.46 55
downstream ENSMUSE00000292212 Chr2:121399281..121399404 TGTTTCGGGAAAAATTGGAA Chr2:121399310..121399329 60.27 35
downstream ENSMUSE00000292204 Chr2:121394629..121394716 AGGGTCCACTCCGTAGGTCT Chr2:121394619..121394638 59.99 60
downstream ENSMUSE00000351539 Chr2:121388621..121388709 GAACAACAAACCCGAAAGGA Chr2:121388633..121388652 59.95 45
downstream ENSMUSE00000392408 Chr2:121383560..121383623 TCAGCTTGGTCACCTCATTC Chr2:121383582..121383601 58.8 50
downstream ENSMUSE00000344482 Chr2:121383053..121383144 AGGCTTGGTTCTCAATTCCA Chr2:121383038..121383057 59.67 45
downstream ENSMUSE00000401873 Chr2:121381306..121381380 GAACAAATTGCTGCTGGACA Chr2:121381310..121381329 59.85 45
downstream ENSMUSE00000360386 Chr2:121380001..121380069 TTGATCTTGGCACTGGACTC Chr2:121380003..121380022 58.8 50
downstream ENSMUSE00000395442 Chr2:121379074..121379180 TGTGCACAGCTCTTCTTCGT Chr2:121379067..121379086 59.78 50
downstream ENSMUSE00000487836 Chr2:121374625..121374968 TGTAGGCCTCATCCGCTATC Chr2:121374809..121374828 60.2 55
downstream ENSMUSE00000684493 Chr2:121374398..121374445 CTCACCACTGAGCGGATTTT Chr2:121374388..121374407 60.26 50
downstream ENSMUSE00000684497 Chr2:121374391..121374968 AGGAGTCCCATGGTCACAAG Chr2:121374547..121374566 59.96 55
downstream ENSMUSE00000684498 Chr2:121374043..121374968 AGGAGTCCCATGGTCACAAG Chr2:121374547..121374566 59.96 55
downstream ENSMUSE00000721682 Chr2:121373823..121374968 AGGAGTCCCATGGTCACAAG Chr2:121374547..121374566 59.96 55
downstream ENSMUSE00000597501 Chr2:121373708..121373759 CTGTAGCTGTGGTCCCTTCAG Chr2:121373708..121373728 59.92 57.14
downstream ENSMUSE00000684507 Chr2:121373617..121373633 No primer for this exon
downstream ENSMUSE00000684501 Chr2:121371267..121373759 GATTTGGCACACGAAAGGTT Chr2:121371363..121371382 59.98 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTGTTTCAGCATTGGTTGGA Chr2:121412195..121412215 59.69 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGATGCGTGACTGGGAAAAC Chr2:121412147..121412167 60.12 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000027238