Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI25489
Trapped Gene
Lmbr1 (ENSMUSG00000010721)
Vector Insertion
Chr 5: 29673447 - 29687587
Public Clones (sanger) (ggtc)
Private Clones OST181631 (lexicon) OST179564 (lexicon)
Severity of mutation (?) Insertion after 12% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000185938 (Chr5:29687588..29687627 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000185938 (Chr5:29687588..29687627 -)
Downstram Exon
ENSMUSE00000185930 (Chr5:29673307..29673446 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000415511 Chr5:29704667..29704839 No primer for this exon
upstream ENSMUSE00000601849 Chr5:29704667..29704930 No primer for this exon
upstream ENSMUSE00000550668 Chr5:29691714..29691746 No primer for this exon
upstream ENSMUSE00000185932 Chr5:29690423..29690495 No primer for this exon
upstream ENSMUSE00000185938 Chr5:29687588..29687627 No primer for this exon

*** Putative Vector Insertion (Chr 5: 29673447 - 29687587) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000185930 Chr5:29673307..29673446 No primer for this exon
downstream ENSMUSE00000185940 Chr5:29650342..29650445 No primer for this exon
downstream ENSMUSE00000601860 Chr5:29619363..29619489 No primer for this exon
downstream ENSMUSE00000601859 Chr5:29618692..29618760 No primer for this exon
downstream ENSMUSE00000601858 Chr5:29617813..29617877 No primer for this exon
downstream ENSMUSE00000601857 Chr5:29613931..29614003 No primer for this exon
downstream ENSMUSE00000601856 Chr5:29589935..29590015 No primer for this exon
downstream ENSMUSE00000601855 Chr5:29585219..29585295 No primer for this exon
downstream ENSMUSE00000601854 Chr5:29584598..29584675 No primer for this exon
downstream ENSMUSE00000601853 Chr5:29581086..29581159 No primer for this exon
downstream ENSMUSE00000601852 Chr5:29580782..29580872 No primer for this exon
downstream ENSMUSE00000601851 Chr5:29579283..29579349 No primer for this exon
downstream ENSMUSE00000601850 Chr5:29561518..29561679 No primer for this exon
downstream ENSMUSE00000474274 Chr5:29556354..29559688 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAACAAGAAGATGAGGATGCTG Chr5:29675602..29675624 58.94 45.46 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAACAAGAAGATGAGGATGCTG Chr5:29675602..29675624 58.94 45.46 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TATTTAATCGCCTTGCAGCAC Chr5:29675560..29675581 60.24 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 TTTGCAGATGAACAAGAAGATGA Chr5:29675610..29675633 59.88 34.78 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000010721