Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI25490
Trapped Gene
Klhdc9 (ENSMUSG00000045259)
Vector Insertion
Chr 1: 173289112 - 173289585
Public Clones not available
Private Clones OST181603 (lexicon) OST40 (lexicon)
Severity of mutation (?) Insertion after 84% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000403325 (Chr1:173289586..173289784 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGGGACCCTTCGCTGTACTA Chr1:173289653..173289672 60.65 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000403325 (Chr1:173289586..173289784 -)
Downstram Exon
ENSMUSE00000372846 (Chr1:173288849..173289111 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGGGACCCTTCGCTGTACTA Chr1:173289653..173289672 60.65 55 CAAACCTGTGGGCTAGCTGT Chr1:173288945..173288964 60.31 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000362387 Chr1:173290266..173290792 GACCACAGGACCCGAACTTA Chr1:173290269..173290288 59.97 55
upstream ENSMUSE00000389865 Chr1:173289873..173290032 CCACACAACCTCACGATCAG Chr1:173289995..173290014 60.15 55
upstream ENSMUSE00000403325 Chr1:173289586..173289784 TGGGACCCTTCGCTGTACTA Chr1:173289653..173289672 60.65 55

*** Putative Vector Insertion (Chr 1: 173289112 - 173289585) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000372846 Chr1:173288849..173289111 CAAACCTGTGGGCTAGCTGT Chr1:173288945..173288964 60.31 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr1:173289515..173289535 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGAGCGCCAAGCTATCATTT Chr1:173289563..173289583 60.88 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000045259