Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI25496
Trapped Gene
Lmna (ENSMUSG00000028063)
Vector Insertion
Chr 3: 88292354 - 88297158
Public Clones CMHD-GT_536A4-5S (cmhd) IST12566H6 (tigm) IST14481F1 (tigm) IST14626B3 (tigm)
IST12304C10 (tigm) IST12304B8 (tigm) IST12304B8 (tigm) IST13499A9 (tigm)
IST14626B3 (tigm) IST12783A1 (tigm)
Private Clones OST181306 (lexicon) OST169201 (lexicon)
Severity of mutation (?) Insertion after 21% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000673454 (Chr3:88297159..88297234 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000673454 (Chr3:88297159..88297234 -)
Downstram Exon
ENSMUSE00000419377 (Chr3:88292197..88292353 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon CAACAAGTCCCCCTCCTTCT Chr3:88292304..88292323 60.48 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000464930 Chr3:88306670..88307229 CAAAGTGCGTGAGGAGTTCA Chr3:88306686..88306705 60.03 50
upstream ENSMUSE00000721382 Chr3:88306670..88307229 CAAAGTGCGTGAGGAGTTCA Chr3:88306686..88306705 60.03 50
upstream ENSMUSE00000673454 Chr3:88297159..88297234 No primer for this exon

*** Putative Vector Insertion (Chr 3: 88292354 - 88297158) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000419377 Chr3:88292197..88292353 CAACAAGTCCCCCTCCTTCT Chr3:88292304..88292323 60.48 55
downstream ENSMUSE00000175618 Chr3:88290730..88290855 CTCCTTCAGCGTCTGTAGCC Chr3:88290741..88290760 60.16 60
downstream ENSMUSE00000175619 Chr3:88290382..88290552 CTTCCCGTTATCGATCTCCA Chr3:88290471..88290490 60.03 50
downstream ENSMUSE00000175620 Chr3:88290126..88290251 GTCAATGCGGATTCGAGACT Chr3:88290140..88290159 60.23 50
downstream ENSMUSE00000175616 Chr3:88288849..88289069 AGCAGCTCCTGGTACTCGTC Chr3:88288896..88288915 59.63 60
downstream ENSMUSE00000175611 Chr3:88288537..88288759 GACTTCCTCTACCGCCACAC Chr3:88288560..88288579 59.73 60
downstream ENSMUSE00000175613 Chr3:88287969..88288076 GGGAAGCGATAGGTCATCAA Chr3:88287984..88288003 60.04 50
downstream ENSMUSE00000175612 Chr3:88287749..88287868 GCCTTCCACACCAAGTCAGT Chr3:88287788..88287807 60.16 55
downstream ENSMUSE00000175621 Chr3:88287240..88287335 TCTTCTCCATCCTCGTCGTC Chr3:88287237..88287256 60.35 55
downstream ENSMUSE00000419350 Chr3:88287128..88287335 TCTTCTCCATCCTCGTCGTC Chr3:88287237..88287256 60.35 55
downstream ENSMUSE00000708285 Chr3:88287127..88287335 TCTTCTCCATCCTCGTCGTC Chr3:88287237..88287256 60.35 55
downstream ENSMUSE00000500596 Chr3:88286268..88286534 TGACTAGGTTGTCCCCGAAG Chr3:88286287..88286306 60.1 55
downstream ENSMUSE00000673455 Chr3:88285996..88286022 ACATGATGCTGCAGTTCTGG Chr3:88285976..88285995 59.86 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTAATCGCCTTGCAGCACATC Chr3:88297087..88297108 63.08 52.38 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGAGCTGGGGTTTGACTTTC Chr3:88297106..88297126 60.23 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 AGGCCTTGCTCTCTCTGGTA Chr3:88297182..88297202 59.19 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 TGCTCTCTCTGGCGTGACTG Chr3:88297176..88297196 62.93 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000028063