Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI25521
Trapped Gene
Psma3 (ENSMUSG00000060073)
Vector Insertion
Chr 12: 72084430 - 72085479
Public Clones Ayu21-W155 (egtc)
Private Clones OST179722 (lexicon)
Severity of mutation (?) Insertion after 30% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000511639 (Chr12:72084306..72084429 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGGTGTTGTGTTTGGGGTAG Chr12:72084333..72084352 59.31 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000511639 (Chr12:72084306..72084429 +)
Downstram Exon
ENSMUSE00000510723 (Chr12:72085480..72085581 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGGTGTTGTGTTTGGGGTAG Chr12:72084333..72084352 59.31 50 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000114394 Chr12:72075720..72075754 No primer for this exon
upstream ENSMUSE00000464712 Chr12:72079720..72079802 ATATGCCATGAAGGCTGTGG Chr12:72079773..72079792 60.88 50
upstream ENSMUSE00000511639 Chr12:72084306..72084429 TGGTGTTGTGTTTGGGGTAG Chr12:72084333..72084352 59.31 50

*** Putative Vector Insertion (Chr 12: 72084430 - 72085479) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000510723 Chr12:72085480..72085581 No primer for this exon
downstream ENSMUSE00000508707 Chr12:72085659..72085732 TGCAGCCAAAAGGTCTAACA Chr12:72085734..72085753 59.46 45
downstream ENSMUSE00000514885 Chr12:72087850..72087922 CACCTGATGGGTCGATCATA Chr12:72087917..72087936 59.32 50
downstream ENSMUSE00000513773 Chr12:72089411..72089476 No primer for this exon
downstream ENSMUSE00000503468 Chr12:72091472..72091518 ATCACGGCAAGTCATTTCCT Chr12:72091498..72091517 59.56 45
downstream ENSMUSE00000502608 Chr12:72094000..72094067 CAGCTGAGCTCCAGTTCAAA Chr12:72094059..72094078 59.31 50
downstream ENSMUSE00000499551 Chr12:72094493..72094557 CTTGGCATATTTCTCTGCTTCC Chr12:72094558..72094579 60.22 45.46
downstream ENSMUSE00000500549 Chr12:72095338..72095492 TGAAAATCGGTCAGTGGGTA Chr12:72095475..72095494 58.97 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CGACATGTTGGAATGGTGAG Chr12:72084416..72084436 59.96 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CGACATGTTGGAATGGTGAG Chr12:72084416..72084436 59.96 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000060073