Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI25535
Trapped Gene
Rab3gap1 (ENSMUSG00000036104)
Vector Insertion
Chr 1: 129770733 - 129785732
Public Clones not available
Private Clones OST178538 (lexicon)
Severity of mutation (?) Insertion after 5% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000455425 (Chr1:129770657..129770732 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATTGGACCCTCTCTGGGAAA Chr1:129770700..129770719 60.82 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000455425 (Chr1:129770657..129770732 +)
Downstram Exon
ENSMUSE00000320668 (Chr1:129785733..129785865 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATTGGACCCTCTCTGGGAAA Chr1:129770700..129770719 60.82 50 TCTGATCGCTCTTCCCATGT Chr1:129785773..129785792 60.77 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000455470 Chr1:129765363..129765406 No primer for this exon
upstream ENSMUSE00000455435 Chr1:129765502..129765557 CCGAGTCCGAAGTGTTTGAG Chr1:129765503..129765522 60.82 55
upstream ENSMUSE00000455425 Chr1:129770657..129770732 ATTGGACCCTCTCTGGGAAA Chr1:129770700..129770719 60.82 50

*** Putative Vector Insertion (Chr 1: 129770733 - 129785732) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000320668 Chr1:129785733..129785865 TCTGATCGCTCTTCCCATGT Chr1:129785773..129785792 60.77 50
downstream ENSMUSE00000320659 Chr1:129787595..129787673 TGCTCTTGGAGGAAAGTCGT Chr1:129787659..129787678 59.99 50
downstream ENSMUSE00000320652 Chr1:129798156..129798275 GCAATCACCACAAACTCACG Chr1:129798188..129798207 60.16 50
downstream ENSMUSE00000320648 Chr1:129800249..129800414 ACGAACACCAGGACCTTGAC Chr1:129800330..129800349 60.01 55
downstream ENSMUSE00000455395 Chr1:129806428..129806527 GCCAATCCTGAAGCACGTAT Chr1:129806500..129806519 60.1 50
downstream ENSMUSE00000455387 Chr1:129812216..129812297 GGATCTTCACAGGCACCAAA Chr1:129812294..129812313 61.05 50
downstream ENSMUSE00000455379 Chr1:129814798..129814866 AGGCCACGTTGTTGCTAAAT Chr1:129814828..129814847 59.64 45
downstream ENSMUSE00000455373 Chr1:129816145..129816218 TTCCGAACTCTAACCGACCA Chr1:129816195..129816214 60.63 50
downstream ENSMUSE00000455364 Chr1:129821305..129821397 TCAAATGTGGATCGTCCAAG Chr1:129821386..129821405 59.5 45
downstream ENSMUSE00000455357 Chr1:129821852..129822018 CCCTCTGTGCTTCCGTATCT Chr1:129821976..129821995 59.31 55
downstream ENSMUSE00000455350 Chr1:129824037..129824126 CTGGTGCAGGAATGCTATTG Chr1:129824115..129824134 59.3 50
downstream ENSMUSE00000455344 Chr1:129824526..129824698 AGGCGCAGACTTGAACTGAT Chr1:129824558..129824577 60.02 50
downstream ENSMUSE00000455335 Chr1:129826967..129827021 AGATCTGGTGATCCACTTGCT Chr1:129826992..129827012 58.76 47.62
downstream ENSMUSE00000334060 Chr1:129827284..129827655 AGGCTCGTCTTTTTCCCTTC Chr1:129827345..129827364 59.83 50
downstream ENSMUSE00000320586 Chr1:129830994..129831131 CCCTCAGCAGATGTCCCTAA Chr1:129831073..129831092 60.21 55
downstream ENSMUSE00000320577 Chr1:129833915..129834142 CCCTTCTCGTCAGTCACCTC Chr1:129834006..129834025 59.83 60
downstream ENSMUSE00000320571 Chr1:129834566..129834662 CCTTGAGAACAGCTGCATGA Chr1:129834653..129834672 60.14 50
downstream ENSMUSE00000320565 Chr1:129834775..129834878 TTGCTGGAATGGGCTATGAT Chr1:129834841..129834860 60.44 45
downstream ENSMUSE00000320557 Chr1:129835152..129835267 TCCTCGTGCTCACACTTCTC Chr1:129835249..129835268 59.13 55
downstream ENSMUSE00000320551 Chr1:129835623..129835725 GATACCTCAGGCTGCTCCAG Chr1:129835661..129835680 59.97 60
downstream ENSMUSE00000402017 Chr1:129838951..129840445 AACCAGCAACGCAGAGAAGT Chr1:129839826..129839845 60.06 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAAGCCACTGGAAAAGGTCA Chr1:129785718..129785738 59.71 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGTTAAATGCAGCGTGACTG Chr1:129782722..129782742 58.5 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000036104