Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI25538
Trapped Gene
Sclt1 (ENSMUSG00000059834)
Vector Insertion
Chr 3: 41538158 - 41545916
Public Clones not available
Private Clones OST178376 (lexicon)
Severity of mutation (?) Insertion after 2% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000568311 (Chr3:41545917..41546436 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCTGCGAGGAATCGATAAAC Chr3:41545981..41546000 59.67 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000568311 (Chr3:41545917..41546436 -)
Downstram Exon
ENSMUSE00000274815 (Chr3:41538090..41538157 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCTGCGAGGAATCGATAAAC Chr3:41545981..41546000 59.67 50 GTTCGATTTGATGCTGCCTA Chr3:41538094..41538113 58.87 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000568311 Chr3:41545917..41546436 CCTGCGAGGAATCGATAAAC Chr3:41545981..41546000 59.67 50

*** Putative Vector Insertion (Chr 3: 41538158 - 41545916) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000274815 Chr3:41538090..41538157 GTTCGATTTGATGCTGCCTA Chr3:41538094..41538113 58.87 45
downstream ENSMUSE00000377441 Chr3:41534783..41534841 CCTCCTTTGGACATGCTGTT Chr3:41534800..41534819 60.11 50
downstream ENSMUSE00000153025 Chr3:41534213..41534285 GCTGCCTGTTTAGCTCTTCC Chr3:41534205..41534224 59.22 55
downstream ENSMUSE00000153030 Chr3:41531015..41531070 TTTCATCTCACCCATGTGCT Chr3:41531028..41531047 59.09 45
downstream ENSMUSE00000153031 Chr3:41521651..41521786 TGAAGGATCCTCACGGTCTC Chr3:41521654..41521673 60.2 55
downstream ENSMUSE00000153027 Chr3:41515005..41515127 TCCAGAGCCCAAGTTTTCTC Chr3:41515086..41515105 59.4 50
downstream ENSMUSE00000153033 Chr3:41513391..41513456 No primer for this exon
downstream ENSMUSE00000153028 Chr3:41507308..41507378 TGTTTTCAGGAAGTGGTGGTT Chr3:41507333..41507353 59.48 42.86
downstream ENSMUSE00000153024 Chr3:41486204..41486294 No primer for this exon
downstream ENSMUSE00000153032 Chr3:41485618..41485709 TCGTCTATCCGACGCTTCTT Chr3:41485637..41485656 59.98 50
downstream ENSMUSE00000494211 Chr3:41479250..41479427 CATCGGCTTCTTCAATTGCT Chr3:41479377..41479396 60.35 45
downstream ENSMUSE00000639377 Chr3:41475307..41475405 TGCTTTGATAGCTGCATCTTG Chr3:41475294..41475314 59.22 42.86
downstream ENSMUSE00000344043 Chr3:41471033..41471104 No primer for this exon
downstream ENSMUSE00000274944 Chr3:41467874..41467948 GGCTCGATCAATTTGACCTT Chr3:41467891..41467910 59.13 45
downstream ENSMUSE00000274938 Chr3:41465494..41465639 GAACGTTCTGCAGCAAGACA Chr3:41465535..41465554 60.18 50
downstream ENSMUSE00000274929 Chr3:41461126..41461318 CATTTCATGGGAACGTGACA Chr3:41461263..41461282 60.37 45
downstream ENSMUSE00000675449 Chr3:41451367..41451563 TGCCTCAGTTCAACAATGGA Chr3:41451438..41451457 60.24 45
downstream ENSMUSE00000675446 Chr3:41435575..41435653 CCACCTTTTCATTTGCCATT Chr3:41435558..41435577 59.8 40
downstream ENSMUSE00000675444 Chr3:41433440..41433535 TGCCTGACTTAGACGCCTTT Chr3:41433448..41433467 60.01 50
downstream ENSMUSE00000675442 Chr3:41430627..41431156 CCATTCTCAGCAGGCTTCTC Chr3:41430985..41431004 60.1 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGAAGCCTTGAGTGCTGATG Chr3:41539878..41539898 60.14 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGAAGCCTTGAGTGCTGATG Chr3:41539878..41539898 60.14 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000059834