Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI2554
Trapped Gene
Topors (ENSMUSG00000036822)
Vector Insertion
Chr 4: 40210115 - 40215336
Public Clones XS0400 (sanger) DTM034 (baygenomics) RRF532 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 6% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000297854 (Chr4:40215337..40215534 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000297854 (Chr4:40215337..40215534 -)
Downstram Exon
ENSMUSE00000345531 (Chr4:40206649..40210114 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon CGGCGACCGTGAAGTATTAT Chr4:40207588..40207607 59.98 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000675605 Chr4:40216707..40216874 GCGAGCCAACAGTCTACCTT Chr4:40216809..40216828 59.5 55
upstream ENSMUSE00000297854 Chr4:40215337..40215534 No primer for this exon

*** Putative Vector Insertion (Chr 4: 40210115 - 40215336) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000345531 Chr4:40206649..40210114 CGGCGACCGTGAAGTATTAT Chr4:40207588..40207607 59.98 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGACCTGGGTCCTTTGTAAAAC Chr4:40215345..40215367 60.25 45.46 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGACCTGGGTCCTTTGTAAAAC Chr4:40215345..40215367 60.25 45.46 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000036822