Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI25551
Trapped Gene
Stx4a (ENSMUSG00000030805)
Vector Insertion
Chr 7: 134985481 - 134985583
Public Clones not available
Private Clones OST177143 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000203629 (Chr7:134985304..134985582 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGGTCCTATGATCGGGTTCT Chr7:134985368..134985387 60.15 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000203629 (Chr7:134985304..134985582 +)
Downstram Exon
ENSMUSE00000710496 (Chr7:134985482..134985582 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGGTCCTATGATCGGGTTCT Chr7:134985368..134985387 60.15 55 TTGGAAGTCCTGCACCTCTC Chr7:134985504..134985523 60.39 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000203629 Chr7:134985304..134985582 GGGTCCTATGATCGGGTTCT Chr7:134985368..134985387 60.15 55

*** Putative Vector Insertion (Chr 7: 134985481 - 134985583) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000710496 Chr7:134985482..134985582 TTGGAAGTCCTGCACCTCTC Chr7:134985504..134985523 60.39 55
downstream ENSMUSE00000203639 Chr7:134985778..134985879 GCGACTCGAACCTCATCTTC Chr7:134985821..134985840 59.96 55
downstream ENSMUSE00000203626 Chr7:134985959..134986058 GCCATAGTCTGCCGAATTGT Chr7:134985987..134986006 60.1 50
downstream ENSMUSE00000203627 Chr7:134986198..134986272 TTTGATCTCCTCTCGCAGGT Chr7:134986241..134986260 59.95 50
downstream ENSMUSE00000203637 Chr7:134987086..134987156 TCCTCCTTCTGGGGCTCTAT Chr7:134987110..134987129 60.17 55
downstream ENSMUSE00000203624 Chr7:134989534..134989642 TGATGAGCTCGACAAATTGC Chr7:134989573..134989592 59.96 45
downstream ENSMUSE00000203631 Chr7:134989714..134989790 GCTCCTCGTCAGACACCATT Chr7:134989746..134989765 60.27 55
downstream ENSMUSE00000203625 Chr7:134990002..134990139 GATACTGCGCTCCAACTGCT Chr7:134990091..134990110 60.57 55
downstream ENSMUSE00000203633 Chr7:134991902..134992012 AGGGCTATCTTGACGTGCTC Chr7:134991990..134992009 59.46 55
downstream ENSMUSE00000203628 Chr7:134992083..134992181 GTGATGCCAATGATGACAGC Chr7:134992153..134992172 60.09 50
downstream ENSMUSE00000709484 Chr7:134992083..134992533 GTGATGCCAATGATGACAGC Chr7:134992153..134992172 60.09 50
downstream ENSMUSE00000339247 Chr7:134992265..134992468 GGAGGACTCCATGAATGAGC Chr7:134992402..134992421 59.62 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000030805