Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI25554
Trapped Gene
Abhd14a (ENSMUSG00000042210)
Vector Insertion
Chr 9: 106342951 - 106343137
Public Clones not available
Private Clones OST177108 (lexicon)
Severity of mutation (?) Insertion after 33% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000261874 (Chr9:106342952..106343187 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACCACCAGCTACGTGGATTC Chr9:106343012..106343031 60 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000261874 (Chr9:106342952..106343187 -)
Downstram Exon
ENSMUSE00000530280 (Chr9:106342952..106343136 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACCACCAGCTACGTGGATTC Chr9:106343012..106343031 60 55 TGTGCATAATTCCTGGTGGA Chr9:106342952..106342971 59.92 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000475377 Chr9:106349862..106349958 GCTAGGCTGTTTGGCAGTTG Chr9:106349921..106349940 60.96 55
upstream ENSMUSE00000432252 Chr9:106348101..106348160 TCTGCATCAGAACCCCTACA Chr9:106348141..106348160 59.24 50
upstream ENSMUSE00000432249 Chr9:106347857..106347982 ACAGCCTGACTTCGGAGCTA Chr9:106347889..106347908 60.16 55
upstream ENSMUSE00000261912 Chr9:106346421..106346637 CCAGAGGCAACTCTCGAATC Chr9:106346459..106346478 59.95 55
upstream ENSMUSE00000530289 Chr9:106346158..106346273 GGCAGAAGTCGTGTTTCTCC Chr9:106346254..106346273 59.85 55
upstream ENSMUSE00000261893 Chr9:106346154..106346275 GGCAGAAGTCGTGTTTCTCC Chr9:106346254..106346273 59.85 55
upstream ENSMUSE00000634556 Chr9:106345969..106346003 AGGTCACGAGAAAGGACCAC Chr9:106345980..106345999 59.15 55
upstream ENSMUSE00000691835 Chr9:106345390..106345407 No primer for this exon
upstream ENSMUSE00000261874 Chr9:106342952..106343187 ACCACCAGCTACGTGGATTC Chr9:106343012..106343031 60 55
upstream ENSMUSE00000530280 Chr9:106342952..106343136 ACCACCAGCTACGTGGATTC Chr9:106343012..106343031 60 55

*** Putative Vector Insertion (Chr 9: 106342951 - 106343137) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000261851 Chr9:106342385..106342735 ATCATGCAGCTTCACCACAG Chr9:106342609..106342628 59.86 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGAGGAGGTGAGCACAGAGG Chr9:106343144..106343164 59.58 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGAGGAGGTGAGCACAGAGG Chr9:106343144..106343164 59.58 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000042210