Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI25559
Trapped Gene
Dctd (ENSMUSG00000031562)
Vector Insertion
Chr 8: 49195603 - 49197012
Public Clones not available
Private Clones OST177033 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000359191 (Chr8:49195539..49195602 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000359191 (Chr8:49195539..49195602 +)
Downstram Exon
ENSMUSE00000399702 (Chr8:49197013..49197144 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon AGGCCACTGCCATGAAATAC Chr8:49197109..49197128 59.96 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000359191 Chr8:49195539..49195602 No primer for this exon

*** Putative Vector Insertion (Chr 8: 49195603 - 49197012) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000399702 Chr8:49197013..49197144 AGGCCACTGCCATGAAATAC Chr8:49197109..49197128 59.96 50
downstream ENSMUSE00000210767 Chr8:49197322..49197457 ATTGTACCCGATCCCAACAA Chr8:49197378..49197397 60.05 45
downstream ENSMUSE00000210765 Chr8:49222612..49222728 TTGTTCATGATGGCGTTCAG Chr8:49222648..49222667 60.67 45
downstream ENSMUSE00000636947 Chr8:49223533..49223606 No primer for this exon
downstream ENSMUSE00000210773 Chr8:49224136..49224232 CTCCTCGCTGTCGTGGTATT Chr8:49224188..49224207 60.28 55
downstream ENSMUSE00000371021 Chr8:49225697..49227017 GACGGGTGAGAAGATTCCAA Chr8:49225968..49225987 60.05 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGTGCTCAGCCTGCTAATCG Chr8:49195640..49195660 63.29 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTGGTCTGCACCTCGAAGGA Chr8:49195577..49195597 63.77 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031562