Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI25563
Trapped Gene
Gap43 (ENSMUSG00000047261)
Vector Insertion
Chr 16: 42292480 - 42340585
Public Clones IST11621F7 (tigm) IST11718F10 (tigm) IST12475A2 (tigm) IST12881D10 (tigm)
IST14964E5 (tigm) IST15086E3 (tigm)
Private Clones OST176779 (lexicon) OST34982 (lexicon) OST13376 (lexicon) OST10543 (lexicon)
Severity of mutation (?) Insertion after 4% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000662700 (Chr16:42340586..42340665 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AAGGCAGGGGAAGATACCAC Chr16:42340617..42340636 60.33 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000662700 (Chr16:42340586..42340665 -)
Downstram Exon
ENSMUSE00000662699 (Chr16:42291912..42292479 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AAGGCAGGGGAAGATACCAC Chr16:42340617..42340636 60.33 55 TTATCTTCCGGCTTGACACC Chr16:42292399..42292418 60.07 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000662700 Chr16:42340586..42340665 AAGGCAGGGGAAGATACCAC Chr16:42340617..42340636 60.33 55

*** Putative Vector Insertion (Chr 16: 42292480 - 42340585) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000662699 Chr16:42291912..42292479 TTATCTTCCGGCTTGACACC Chr16:42292399..42292418 60.07 50
downstream ENSMUSE00000662698 Chr16:42248557..42249227 GAACGGAACATTGCACACAC Chr16:42248743..42248762 60.02 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATAATCGCCTTGCAGCAC Chr16:42328517..42328537 58.94 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTCTCGTGACTGGGAAAACC Chr16:42328518..42328538 60.09 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 ACCATGCATATTGCAGACGA Chr16:42328691..42328711 60.1 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 ACCATGCATATTGCAGACGA Chr16:42328691..42328711 60.1 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000047261