Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI25564
Trapped Gene
Nme6 (ENSMUSG00000032478)
Vector Insertion
Chr 9: 109735555 - 109735810
Public Clones not available
Private Clones OST176763 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000715199 (Chr9:109735544..109735809 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCCTTGGAATGGCTAGATCA Chr9:109735746..109735765 60.18 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000715199 (Chr9:109735544..109735809 +)
Downstram Exon
ENSMUSE00000717243 (Chr9:109735556..109735809 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCCTTGGAATGGCTAGATCA Chr9:109735746..109735765 60.18 50 ACAAGAAAGTGCTGCCAAGC Chr9:109735659..109735678 60.58 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000634059 Chr9:109735308..109735321 No primer for this exon
upstream ENSMUSE00000715199 Chr9:109735544..109735809 GCCTTGGAATGGCTAGATCA Chr9:109735746..109735765 60.18 50

*** Putative Vector Insertion (Chr 9: 109735555 - 109735810) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000717243 Chr9:109735556..109735809 ACAAGAAAGTGCTGCCAAGC Chr9:109735659..109735678 60.58 50
downstream ENSMUSE00000490950 Chr9:109735710..109735809 TGCATGAACCTGATCTAGCC Chr9:109735778..109735797 58.83 50
downstream ENSMUSE00000345083 Chr9:109737832..109737928 CTTCGCAAGATGGAGGTCAT Chr9:109737861..109737880 60.22 50
downstream ENSMUSE00000712552 Chr9:109737832..109737928 CTTCGCAAGATGGAGGTCAT Chr9:109737861..109737880 60.22 50
downstream ENSMUSE00000312551 Chr9:109742122..109742224 GTAAAACCTCCGGCAGTCCT Chr9:109742214..109742233 60.5 55
downstream ENSMUSE00000312527 Chr9:109743990..109744029 ACCAGCCGCTGATAGAAAAA Chr9:109744017..109744036 59.85 45
downstream ENSMUSE00000219948 Chr9:109744441..109744601 GTCAGTGAGGCCCAAACTTC Chr9:109744579..109744598 59.7 55
downstream ENSMUSE00000713716 Chr9:109744476..109744601 GTCAGTGAGGCCCAAACTTC Chr9:109744579..109744598 59.7 55
downstream ENSMUSE00000312476 Chr9:109744966..109745475 GTTACCCAGGCACTGCATTT Chr9:109745432..109745451 60 50
downstream ENSMUSE00000716148 Chr9:109744966..109745238 TTCAGACCACCTTCCCTGAC Chr9:109745223..109745242 60.09 55
downstream ENSMUSE00000718168 Chr9:109744966..109745175 CAGCGCTGTTCACTGAAGTC Chr9:109745032..109745051 59.78 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCGCTAAAGTAGTGGCTTCC Chr9:109735549..109735569 59.14 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATGTCCGTGACTGGGAAAAC Chr9:109735601..109735621 59.83 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032478