Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI25567
Trapped Gene
Sh3pxd2b (ENSMUSG00000040711)
Vector Insertion
Chr 11: 32247969 - 32271517
Public Clones IST13674B4 (tigm)
Private Clones OST176530 (lexicon)
Severity of mutation (?) Insertion after 3% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000377217 (Chr11:32247811..32247968 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCAGTATCGTGGAGGTGAAG Chr11:32247907..32247926 58.31 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000377217 (Chr11:32247811..32247968 +)
Downstram Exon
ENSMUSE00000252676 (Chr11:32271518..32271598 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCAGTATCGTGGAGGTGAAG Chr11:32247907..32247926 58.31 55 CACGTGACTCGGATGATGTAG Chr11:32271542..32271562 59.18 52.38

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000377217 Chr11:32247811..32247968 GCAGTATCGTGGAGGTGAAG Chr11:32247907..32247926 58.31 55

*** Putative Vector Insertion (Chr 11: 32247969 - 32271517) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000252676 Chr11:32271518..32271598 CACGTGACTCGGATGATGTAG Chr11:32271542..32271562 59.18 52.38
downstream ENSMUSE00000252663 Chr11:32281434..32281509 CTCTGCTTGGGGTCTTTCTG Chr11:32281492..32281511 59.98 55
downstream ENSMUSE00000252655 Chr11:32287928..32288004 CAATTGGTATCAGGCGTTTG Chr11:32287993..32288012 59.04 45
downstream ENSMUSE00000358483 Chr11:32296442..32296533 GGTCCTCAGGTCTTGTCTCG Chr11:32296520..32296539 59.83 60
downstream ENSMUSE00000464366 Chr11:32297066..32297091 No primer for this exon
downstream ENSMUSE00000346005 Chr11:32303861..32303995 GTCCACTACTTGGCCCACAC Chr11:32303976..32303995 60.43 60
downstream ENSMUSE00000383882 Chr11:32307562..32307666 AGGCTGGAGGGAGAACTCAT Chr11:32307662..32307681 60.22 55
downstream ENSMUSE00000343044 Chr11:32311457..32311574 TCCAGGTTCTTCTGGACGAC Chr11:32311559..32311578 60.24 55
downstream ENSMUSE00000359998 Chr11:32314201..32314427 TCTGCTTAACGTCACCATCG Chr11:32314430..32314449 59.86 50
downstream ENSMUSE00000410564 Chr11:32315923..32315972 GGGGTCTTTGCCTCATCTTT Chr11:32315952..32315971 60.44 50
downstream ENSMUSE00000374504 Chr11:32317080..32317205 TGGAACTCAGCGATGGTGTA Chr11:32317159..32317178 60.26 50
downstream ENSMUSE00000361562 Chr11:32322023..32328183 AGGGGCTTGGTACCTCAACT Chr11:32327433..32327452 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCTTGTCAGGTTGCCCTCTC Chr11:32268991..32269011 60.39 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCTTGTCAGGTTGCCCTCTC Chr11:32268991..32269011 60.39 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000040711