Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI25570
Trapped Gene
Ipo4 (ENSMUSG00000002319)
Vector Insertion
Chr 14: 56253247 - 56253841
Public Clones not available
Private Clones OST176374 (lexicon)
Severity of mutation (?) Insertion after 9% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000372139 (Chr14:56253842..56253883 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000372139 (Chr14:56253842..56253883 -)
Downstram Exon
ENSMUSE00000315944 (Chr14:56253117..56253246 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000344855 Chr14:56254367..56254515 No primer for this exon
upstream ENSMUSE00000124534 Chr14:56254200..56254286 No primer for this exon
upstream ENSMUSE00000394598 Chr14:56253969..56254048 No primer for this exon
upstream ENSMUSE00000372139 Chr14:56253842..56253883 No primer for this exon

*** Putative Vector Insertion (Chr 14: 56253247 - 56253841) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000315944 Chr14:56253117..56253246 No primer for this exon
downstream ENSMUSE00000316091 Chr14:56252852..56253031 No primer for this exon
downstream ENSMUSE00000124515 Chr14:56252549..56252614 No primer for this exon
downstream ENSMUSE00000124537 Chr14:56252342..56252443 No primer for this exon
downstream ENSMUSE00000124513 Chr14:56252171..56252254 No primer for this exon
downstream ENSMUSE00000124526 Chr14:56251798..56251962 No primer for this exon
downstream ENSMUSE00000124538 Chr14:56251137..56251190 No primer for this exon
downstream ENSMUSE00000124540 Chr14:56250870..56250979 No primer for this exon
downstream ENSMUSE00000401447 Chr14:56250269..56250377 No primer for this exon
downstream ENSMUSE00000124535 Chr14:56249979..56250108 No primer for this exon
downstream ENSMUSE00000370393 Chr14:56249654..56249767 No primer for this exon
downstream ENSMUSE00000316034 Chr14:56249435..56249548 No primer for this exon
downstream ENSMUSE00000378620 Chr14:56249132..56249252 No primer for this exon
downstream ENSMUSE00000374464 Chr14:56248815..56248926 No primer for this exon
downstream ENSMUSE00000124516 Chr14:56248586..56248704 No primer for this exon
downstream ENSMUSE00000388413 Chr14:56248231..56248308 No primer for this exon
downstream ENSMUSE00000342359 Chr14:56248097..56248154 No primer for this exon
downstream ENSMUSE00000124527 Chr14:56247904..56248012 No primer for this exon
downstream ENSMUSE00000398621 Chr14:56247631..56247824 No primer for this exon
downstream ENSMUSE00000315996 Chr14:56247429..56247476 No primer for this exon
downstream ENSMUSE00000124514 Chr14:56246943..56247068 No primer for this exon
downstream ENSMUSE00000315984 Chr14:56246622..56246830 No primer for this exon
downstream ENSMUSE00000411118 Chr14:56246372..56246504 No primer for this exon
downstream ENSMUSE00000124517 Chr14:56246177..56246281 No primer for this exon
downstream ENSMUSE00000124530 Chr14:56244991..56245060 No primer for this exon
downstream ENSMUSE00000648583 Chr14:56244466..56244878 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACTCTCGGGGGTCCTAACTG Chr14:56253803..56253823 60.5 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAGACGTGACTGGGAAAACC Chr14:56253774..56253794 59.56 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000002319