Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI25576
Trapped Gene
Slc25a12 (ENSMUSG00000027010)
Vector Insertion
Chr 2: 71162173 - 71171661
Public Clones E050H05 (ggtc) E050H05 (ggtc) IST15052D11 (tigm)
Private Clones OST176009 (lexicon)
Severity of mutation (?) Insertion after 16% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000320612 (Chr2:71171662..71171777 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GACAAGAGCGGAAATGGAGA Chr2:71171673..71171692 60.34 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000320612 (Chr2:71171662..71171777 -)
Downstram Exon
ENSMUSE00000165429 (Chr2:71162033..71162172 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GACAAGAGCGGAAATGGAGA Chr2:71171673..71171692 60.34 50 TCTGCCCAAAAATCTCCTTG Chr2:71162124..71162143 60.18 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000662334 Chr2:71205570..71205640 No primer for this exon
upstream ENSMUSE00000662333 Chr2:71204584..71204637 CAACCAAACGAGGTGATCCT Chr2:71204611..71204630 59.97 50
upstream ENSMUSE00000662332 Chr2:71181947..71182089 ACCCAAAGATTGTGCAGCTC Chr2:71181979..71181998 60.26 50
upstream ENSMUSE00000320612 Chr2:71171662..71171777 GACAAGAGCGGAAATGGAGA Chr2:71171673..71171692 60.34 50

*** Putative Vector Insertion (Chr 2: 71162173 - 71171661) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000165429 Chr2:71162033..71162172 TCTGCCCAAAAATCTCCTTG Chr2:71162124..71162143 60.18 45
downstream ENSMUSE00000165435 Chr2:71153040..71153186 GAAATCCAGACCCGAGATCA Chr2:71153084..71153103 60.01 50
downstream ENSMUSE00000566456 Chr2:71150482..71150620 TATCTTTCCTCGTGCCTGCT Chr2:71150475..71150494 59.98 50
downstream ENSMUSE00000165430 Chr2:71149520..71149613 No primer for this exon
downstream ENSMUSE00000320519 Chr2:71146113..71146197 GCGGAGCTATTCTCTCGATG Chr2:71146138..71146157 60.08 55
downstream ENSMUSE00000320512 Chr2:71136627..71136708 CTGGAGCCAGATAGGTCTGC Chr2:71136651..71136670 59.97 60
downstream ENSMUSE00000566451 Chr2:71134722..71134880 TCCAAAGAAACCCTCGTAGC Chr2:71134710..71134729 59.31 50
downstream ENSMUSE00000165434 Chr2:71131729..71131781 TTTCTGGTGCAACCCCTATC Chr2:71131724..71131743 59.93 50
downstream ENSMUSE00000165424 Chr2:71131417..71131497 GCAACCTCCAGCAAGGATTT Chr2:71131395..71131414 61.51 50
downstream ENSMUSE00000566446 Chr2:71120527..71120667 CCTGAAGCACATTCAGAGCA Chr2:71120531..71120550 60.14 50
downstream ENSMUSE00000165433 Chr2:71117573..71117711 GTGAGCGTACACGGGAAAAT Chr2:71117624..71117643 60 50
downstream ENSMUSE00000165428 Chr2:71114698..71114856 CCTTCTTCCCGGAGAATCTT Chr2:71114705..71114724 59.65 50
downstream ENSMUSE00000566445 Chr2:71114489..71114579 GAGGTGAGGATCGAAACACC Chr2:71114534..71114553 59.51 55
downstream ENSMUSE00000662331 Chr2:71112803..71113410 CCTGGGCGTATGATCACTTT Chr2:71113052..71113071 59.96 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CGGAAATGGAGAGGTGACAT Chr2:71165663..71165683 59.93 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CGGAAATGGAGAGGTGACAT Chr2:71165663..71165683 59.93 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TATTTAATCGCCTTGCAGCAC Chr2:71165710..71165731 60.24 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 TGGATTTTAGGGGGATTTCA Chr2:71165750..71165770 59.2 40 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000027010