Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI25580
Trapped Gene
Saal1 (ENSMUSG00000006763)
Vector Insertion
Chr 7: 53964348 - 53965867
Public Clones IST14280G12 (tigm)
Private Clones OST175675 (lexicon)
Severity of mutation (?) Insertion after 9% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000221951 (Chr7:53965868..53966033 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000221951 (Chr7:53965868..53966033 -)
Downstram Exon
ENSMUSE00000204195 (Chr7:53964234..53964347 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000221951 Chr7:53965868..53966033 No primer for this exon

*** Putative Vector Insertion (Chr 7: 53964348 - 53965867) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000204195 Chr7:53964234..53964347 No primer for this exon
downstream ENSMUSE00000204203 Chr7:53962363..53962446 No primer for this exon
downstream ENSMUSE00000204196 Chr7:53959384..53959463 No primer for this exon
downstream ENSMUSE00000204200 Chr7:53957991..53958050 No primer for this exon
downstream ENSMUSE00000204197 Chr7:53957772..53957887 No primer for this exon
downstream ENSMUSE00000204201 Chr7:53957151..53957331 No primer for this exon
downstream ENSMUSE00000204202 Chr7:53955006..53955088 No primer for this exon
downstream ENSMUSE00000204198 Chr7:53954734..53954922 No primer for this exon
downstream ENSMUSE00000204204 Chr7:53948149..53948345 No primer for this exon
downstream ENSMUSE00000204199 Chr7:53945173..53945265 No primer for this exon
downstream ENSMUSE00000634652 Chr7:53944680..53944825 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAGTGGACGGGATGTAATCG Chr7:53965810..53965830 60.34 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CGGTCTACAGCAAGCACTGG Chr7:53965896..53965916 61.97 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 AACCCGTCTTAATCGCCTTG Chr7:53965972..53965992 61.35 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GTCTCGTGACTGGGAAAACC Chr7:53965967..53965987 59.56 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000006763