Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI25584
Trapped Gene
Spata1 (ENSMUSG00000028188)
Vector Insertion
Chr 3: 146156808 - 146157919
Public Clones not available
Private Clones OST175239 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000586216 (Chr3:146157920..146158079 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCGTCCTTTCTCCTTCGTCT Chr3:146157962..146157981 60.76 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000586216 (Chr3:146157920..146158079 -)
Downstram Exon
ENSMUSE00000358153 (Chr3:146156636..146156807 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCGTCCTTTCTCCTTCGTCT Chr3:146157962..146157981 60.76 55 ATGGTCGACTTGGATTGAGC Chr3:146156625..146156644 60.08 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000561579 Chr3:146162619..146162717 No primer for this exon
upstream ENSMUSE00000586216 Chr3:146157920..146158079 CCGTCCTTTCTCCTTCGTCT Chr3:146157962..146157981 60.76 55

*** Putative Vector Insertion (Chr 3: 146156808 - 146157919) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000358153 Chr3:146156636..146156807 ATGGTCGACTTGGATTGAGC Chr3:146156625..146156644 60.08 50
downstream ENSMUSE00000225508 Chr3:146152775..146152881 CACGATCCTTCAGGGACATAA Chr3:146152819..146152839 59.94 47.62
downstream ENSMUSE00000225497 Chr3:146151611..146151728 AAGACGCTCCCTCAGAGCTT Chr3:146151664..146151683 60.67 55
downstream ENSMUSE00000225484 Chr3:146150476..146150529 No primer for this exon
downstream ENSMUSE00000365374 Chr3:146150164..146150383 TTGGATTTCCAGGTTCATCC Chr3:146150187..146150206 59.73 45
downstream ENSMUSE00000586215 Chr3:146148375..146150529 AGGCTAGACAATCGCAAGGA Chr3:146149779..146149798 59.98 50
downstream ENSMUSE00000225459 Chr3:146144731..146144824 CTTCCAATGATCCCAGCAAC Chr3:146144740..146144759 60.46 50
downstream ENSMUSE00000225447 Chr3:146144092..146144173 GCTGAGAGCTGCGTTATCCT Chr3:146144088..146144107 59.75 55
downstream ENSMUSE00000225433 Chr3:146139158..146139266 AAACCCGCTGAGAAGGAAAT Chr3:146139175..146139194 60.07 45
downstream ENSMUSE00000177113 Chr3:146138220..146138345 No primer for this exon
downstream ENSMUSE00000177109 Chr3:146132589..146132767 CAAATTCCTTGGTCGCATCT Chr3:146132588..146132607 60.07 45
downstream ENSMUSE00000177107 Chr3:146131070..146131168 AAGTTGGTCAATTGCGTGCT Chr3:146131096..146131115 60.7 45
downstream ENSMUSE00000370519 Chr3:146128873..146128960 GAAAGGTGCACCCATTTTCT Chr3:146128864..146128883 59.03 45
downstream ENSMUSE00000399643 Chr3:146126149..146126219 TCTAGGTTGGCACACTTCCA Chr3:146126174..146126193 59.29 50
downstream ENSMUSE00000342571 Chr3:146120167..146120468 GTCACCAAAGCGCATAGACA Chr3:146120298..146120317 59.87 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000028188