Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI2559
Trapped Gene
Uty (ENSMUSG00000068457)
Vector Insertion
Chr Y: 535957 - 560939
Public Clones XS0378 (sanger) (sanger) (ggtc) (ggtc) IST11384E7 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 51% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000626517 (ChrY:560940..560989 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000626517 (ChrY:560940..560989 -)
Downstram Exon
ENSMUSE00000626516 (ChrY:535898..535956 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000577901 ChrY:581850..582181 GAAGGCGCTTTGTGGATTAG ChrY:581854..581873 59.85 50
upstream ENSMUSE00000626519 ChrY:581599..581662 CAGCTTCTTCGGGTTCTTGA ChrY:581643..581662 60.51 50
upstream ENSMUSE00000626518 ChrY:576154..576262 GCTGAAGGAAAAGTGGAATCAG ChrY:576208..576229 60.24 45.46
upstream ENSMUSE00000626517 ChrY:560940..560989 No primer for this exon

*** Putative Vector Insertion (Chr Y: 535957 - 560939) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000626516 ChrY:535898..535956 No primer for this exon
downstream ENSMUSE00000626515 ChrY:533649..533769 TGGCTCTGCAAAAATTAGGG ChrY:533692..533711 60.2 45
downstream ENSMUSE00000626514 ChrY:525779..525833 GATCAGGGCCAGCTGAAAAT ChrY:525791..525810 61.49 50
downstream ENSMUSE00000626513 ChrY:523217..523251 No primer for this exon
downstream ENSMUSE00000626512 ChrY:512934..513027 ATAGGCTGCCTTTGCAGAAT ChrY:512976..512995 58.96 45
downstream ENSMUSE00000626511 ChrY:511171..511297 No primer for this exon
downstream ENSMUSE00000441428 ChrY:510235..510271 No primer for this exon
downstream ENSMUSE00000626510 ChrY:507347..507445 AAAGGCATCCTGAACCTTCC ChrY:507387..507406 60.44 50
downstream ENSMUSE00000626509 ChrY:506408..506627 CTTGCAAGGCATCCATAGGT ChrY:506562..506581 60.1 50
downstream ENSMUSE00000626508 ChrY:505566..505700 GGTAAGCTCTGCGGGTATTG ChrY:505577..505596 59.73 55
downstream ENSMUSE00000626507 ChrY:504533..504628 CTGTGCTGTGAAGCACTGTGT ChrY:504520..504540 60.15 52.38
downstream ENSMUSE00000626506 ChrY:494350..495077 TGCTTGGAGATATCGTGTGG ChrY:494996..495015 59.67 50
downstream ENSMUSE00000626505 ChrY:490598..490727 TGGGTGGATTCAACTTCTCC ChrY:490590..490609 59.9 50
downstream ENSMUSE00000626504 ChrY:489212..489317 GCAAGACCGCGAATTACTGT ChrY:489207..489226 60.28 50
downstream ENSMUSE00000626503 ChrY:488391..488596 CAGAGGGATCCCAGTTTTCA ChrY:488467..488486 60.04 50
downstream ENSMUSE00000626502 ChrY:474250..474314 No primer for this exon
downstream ENSMUSE00000626501 ChrY:474101..474175 GGGTGCTTTCTGTCTCCTTC ChrY:474129..474148 58.87 55
downstream ENSMUSE00000626500 ChrY:473291..473439 GCAGGAAGCTTTGTCAGCTC ChrY:473379..473398 60.28 55
downstream ENSMUSE00000626499 ChrY:471315..471429 TTCACAATCACCTGGACCAA ChrY:471346..471365 59.94 45
downstream ENSMUSE00000626498 ChrY:467479..467666 CAGTGCCTGCATTTATCCAA ChrY:467520..467539 59.69 45
downstream ENSMUSE00000626497 ChrY:466313..466454 No primer for this exon
downstream ENSMUSE00000626496 ChrY:439208..439334 CCATGCCACAAAACCTCTTT ChrY:439229..439248 59.97 45
downstream ENSMUSE00000568719 ChrY:436025..436195 TTTCGTGCACAGTTCTGACA ChrY:436088..436107 59 45
downstream ENSMUSE00000704564 ChrY:433587..435016 TGCGTAAGTCTCCCAACACA ChrY:433592..433611 60.3 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGACCTAGCCAGGTGTGGAA ChrY:542962..542982 59.72 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGACCTAGCCAGGTGTGGAA ChrY:542962..542982 59.72 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 AGAACGTGACTGGGAAAACC ChrY:545923..545943 59.04 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000068457