Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI25594
Trapped Gene
Hcfc1r1 (ENSMUSG00000023904)
Vector Insertion
Chr 17: 23811643 - 23811850
Public Clones not available
Private Clones OST174892 (lexicon) OST23183 (lexicon) OST18631 (lexicon) OST18630 (lexicon)
Severity of mutation (?) Insertion after 63% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000136264 (Chr17:23811502..23811642 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACCTTTGCACAAGCAGTTCC Chr17:23811517..23811536 60.3 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000136264 (Chr17:23811502..23811642 +)
Downstram Exon
ENSMUSE00000136265 (Chr17:23811851..23812192 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACCTTTGCACAAGCAGTTCC Chr17:23811517..23811536 60.3 50 TTCCACCGAGCTAGTGTCCT Chr17:23812124..23812143 59.87 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000136263 Chr17:23810924..23811035 AGCCGTAATGATCCTGCAAC Chr17:23810943..23810962 60.1 50
upstream ENSMUSE00000136264 Chr17:23811502..23811642 ACCTTTGCACAAGCAGTTCC Chr17:23811517..23811536 60.3 50

*** Putative Vector Insertion (Chr 17: 23811643 - 23811850) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000136265 Chr17:23811851..23812192 TTCCACCGAGCTAGTGTCCT Chr17:23812124..23812143 59.87 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGTCCTCAGTAATCGCCTTG Chr17:23811685..23811705 59.69 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGATCACATTCGGTCCTCAG Chr17:23811674..23811694 60.47 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000023904