Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI25597
Trapped Gene
Taf6l (ENSMUSG00000003680)
Vector Insertion
Chr 19: 8858485 - 8859611
Public Clones not available
Private Clones OST174469 (lexicon) OST156308 (lexicon) OST52273 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000234119 (Chr19:8859612..8859668 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000234119 (Chr19:8859612..8859668 -)
Downstram Exon
ENSMUSE00000234094 (Chr19:8858325..8858484 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000234142 Chr19:8860700..8860753 No primer for this exon
upstream ENSMUSE00000234119 Chr19:8859612..8859668 No primer for this exon

*** Putative Vector Insertion (Chr 19: 8858485 - 8859611) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000234094 Chr19:8858325..8858484 No primer for this exon
downstream ENSMUSE00000144064 Chr19:8857794..8857880 No primer for this exon
downstream ENSMUSE00000144065 Chr19:8857034..8857184 No primer for this exon
downstream ENSMUSE00000144066 Chr19:8856846..8856896 No primer for this exon
downstream ENSMUSE00000144062 Chr19:8856491..8856585 No primer for this exon
downstream ENSMUSE00000144060 Chr19:8853341..8853415 No primer for this exon
downstream ENSMUSE00000144061 Chr19:8853003..8853223 No primer for this exon
downstream ENSMUSE00000144057 Chr19:8852577..8852709 No primer for this exon
downstream ENSMUSE00000144059 Chr19:8849880..8850008 No primer for this exon
downstream ENSMUSE00000233870 Chr19:8848984..8849780 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTAATCGCCTTGCAGCACAT Chr19:8859541..8859561 61.69 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAGCTCGTGACTGGGAAAAC Chr19:8859545..8859565 59.85 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000003680