Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI25600
Trapped Gene
Ndufc2 (ENSMUSG00000030647)
Vector Insertion
Chr 7: 104548868 - 104555375
Public Clones not available
Private Clones OST174143 (lexicon)
Severity of mutation (?) Insertion after 47% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000201579 (Chr7:104548606..104548867 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCGTTTGGAGTCGTTGTTTT Chr7:104548631..104548650 60.15 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000201579 (Chr7:104548606..104548867 +)
Downstram Exon
ENSMUSE00000201580 (Chr7:104555376..104555519 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCGTTTGGAGTCGTTGTTTT Chr7:104548631..104548650 60.15 45 GGACGTAACGAACAGAAGCTG Chr7:104555409..104555429 59.93 52.38

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000201579 Chr7:104548606..104548867 GCGTTTGGAGTCGTTGTTTT Chr7:104548631..104548650 60.15 45

*** Putative Vector Insertion (Chr 7: 104548868 - 104555375) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000201580 Chr7:104555376..104555519 GGACGTAACGAACAGAAGCTG Chr7:104555409..104555429 59.93 52.38
downstream ENSMUSE00000201581 Chr7:104556129..104556309 TGAAAACTTCAACGCACTGG Chr7:104556189..104556208 59.88 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCATTTCATAATCGCCTTGC Chr7:104551911..104551931 58.72 40 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGGACTAATTGGCCTTTGCT Chr7:104551831..104551851 60.45 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000030647