Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI25604
Trapped Gene
Fgfr1 (ENSMUSG00000031565)
Vector Insertion
Chr 8: 26684216 - 26685050
Public Clones not available
Private Clones OST174078 (lexicon) OST31014 (lexicon)
Severity of mutation (?) Insertion after 92% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000710211 (Chr8:26684217..26685253 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTTGCCAACAGTGGACTCAA Chr8:26684364..26684383 59.87 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000710211 (Chr8:26684217..26685253 +)
Downstram Exon
ENSMUSE00000711336 (Chr8:26684217..26685049 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTTGCCAACAGTGGACTCAA Chr8:26684364..26684383 59.87 50 TTGAGTCCACTGTTGGCAAG Chr8:26684386..26684405 59.87 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000684681 Chr8:26629244..26629901 CCGGACTGGACTGAGACTGT Chr8:26629401..26629420 60.31 60
upstream ENSMUSE00000708961 Chr8:26629264..26629901 CCGGACTGGACTGAGACTGT Chr8:26629401..26629420 60.31 60
upstream ENSMUSE00000715929 Chr8:26629267..26629901 CCGGACTGGACTGAGACTGT Chr8:26629401..26629420 60.31 60
upstream ENSMUSE00000712953 Chr8:26629791..26629901 No primer for this exon
upstream ENSMUSE00000368001 Chr8:26642722..26642900 CCAACCTCTAACCGCAGAAC Chr8:26642786..26642805 59.73 55
upstream ENSMUSE00000710039 Chr8:26642722..26642900 CCAACCTCTAACCGCAGAAC Chr8:26642786..26642805 59.73 55
upstream ENSMUSE00000720184 Chr8:26642753..26642900 CCAACCTCTAACCGCAGAAC Chr8:26642786..26642805 59.73 55
upstream ENSMUSE00000210796 Chr8:26665944..26666246 ATGTGCAGAGCATCAACTGG Chr8:26666067..26666086 59.86 50
upstream ENSMUSE00000710493 Chr8:26665980..26666246 ATGTGCAGAGCATCAACTGG Chr8:26666067..26666086 59.86 50
upstream ENSMUSE00000514872 Chr8:26668203..26668292 ATCCTCGGAAGATGATGACG Chr8:26668213..26668232 60.03 50
upstream ENSMUSE00000684676 Chr8:26668203..26668286 ATCCTCGGAAGATGATGACG Chr8:26668213..26668232 60.03 50
upstream ENSMUSE00000210804 Chr8:26668543..26668715 TTTAAGCCTGACCACCGAAT Chr8:26668683..26668702 59.57 45
upstream ENSMUSE00000210814 Chr8:26671192..26671315 CTACACCTGCATCGTGGAGA Chr8:26671251..26671270 59.85 55
upstream ENSMUSE00000523250 Chr8:26672610..26672800 TGAAGCACATCGAGGTGAAC Chr8:26672733..26672752 59.84 50
upstream ENSMUSE00000715252 Chr8:26673846..26673996 AGAGCGGGGAGTATGTGTGT Chr8:26673907..26673926 59.6 55
upstream ENSMUSE00000523249 Chr8:26674812..26674956 TGCTTGGCGGGTAACTCTAT Chr8:26674896..26674915 59.73 50
upstream ENSMUSE00000210792 Chr8:26677183..26677385 ACCAAGAAGAGCGACTTCCA Chr8:26677308..26677327 59.99 50
upstream ENSMUSE00000711525 Chr8:26677183..26677379 ACCAAGAAGAGCGACTTCCA Chr8:26677308..26677327 59.99 50
upstream ENSMUSE00000716690 Chr8:26678288..26678293 No primer for this exon
upstream ENSMUSE00000253494 Chr8:26678660..26678805 GGCTGGAGTCTCCGAATATG Chr8:26678746..26678765 59.65 55
upstream ENSMUSE00000210806 Chr8:26680111..26680232 GGGCTGGATAAGGACAAACC Chr8:26680175..26680194 60.69 55
upstream ENSMUSE00000210795 Chr8:26680613..26680723 TCGGAGATGGAGATGATGAA Chr8:26680648..26680667 59.12 45
upstream ENSMUSE00000523247 Chr8:26681182..26681372 AGTACGCCTCCAAAGGCAAT Chr8:26681203..26681222 61.01 50
upstream ENSMUSE00000253463 Chr8:26682810..26682932 CTGGTGACCGAGGATAACGTA Chr8:26682843..26682863 60 52.38
upstream ENSMUSE00000523246 Chr8:26683191..26683261 TGACCGGATCTACACACACC Chr8:26683232..26683251 59.39 55
upstream ENSMUSE00000210794 Chr8:26683595..26683732 AGGGTCATCGAATGGACAAG Chr8:26683690..26683709 59.93 50
upstream ENSMUSE00000523245 Chr8:26684018..26684123 AGCAGTTGGTGGAAGACCTG Chr8:26684074..26684093 60.3 55

*** Putative Vector Insertion (Chr 8: 26684216 - 26685050) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000608945 Chr8:26684217..26686186 TTGAGTGGTGTGGGTTTGAA Chr8:26685823..26685842 59.98 45
downstream ENSMUSE00000710211 Chr8:26684217..26685253 TTGAGTCCACTGTTGGCAAG Chr8:26684386..26684405 59.87 50
downstream ENSMUSE00000711336 Chr8:26684217..26685049 TTGAGTCCACTGTTGGCAAG Chr8:26684386..26684405 59.87 50
downstream ENSMUSE00000718819 Chr8:26684217..26684393 GTACTGGTCCAGCGGTATGG Chr8:26684255..26684274 60.4 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCAGCTTTCTAATCGCCTTG Chr8:26684258..26684278 59.97 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TACCGCTGGACCAGTACTCA Chr8:26684237..26684257 59.31 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031565