Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI25606
Trapped Gene
Cacng6 (ENSMUSG00000078815)
Vector Insertion
Chr 7: 3432675 - 3435419
Public Clones not available
Private Clones OST174061 (lexicon)
Severity of mutation (?) Insertion after 70% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000677462 (Chr7:3432537..3432674 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATTGGGAGCTGTCTGCTTTG Chr7:3432646..3432665 60.4 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000677462 (Chr7:3432537..3432674 +)
Downstram Exon
ENSMUSE00000677461 (Chr7:3435420..3435658 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATTGGGAGCTGTCTGCTTTG Chr7:3432646..3432665 60.4 50 CAAGGTGAGCAGGAGGAAAC Chr7:3435607..3435626 59.84 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000677464 Chr7:3425423..3425753 CAGAATCTCGGCTTGACTCC Chr7:3425501..3425520 59.95 55
upstream ENSMUSE00000677463 Chr7:3431156..3431230 No primer for this exon
upstream ENSMUSE00000677462 Chr7:3432537..3432674 ATTGGGAGCTGTCTGCTTTG Chr7:3432646..3432665 60.4 50

*** Putative Vector Insertion (Chr 7: 3432675 - 3435419) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000677461 Chr7:3435420..3435658 CAAGGTGAGCAGGAGGAAAC Chr7:3435607..3435626 59.84 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000078815