Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI25643
Trapped Gene
Cngb1 (ENSMUSG00000031789)
Vector Insertion
Chr 8: 97794702 - 97794866
Public Clones not available
Private Clones OST172096 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000243266 (Chr8:97794703..97794865 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GACACTCCCTCCACCTGAGA Chr8:97794770..97794789 60.24 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000243266 (Chr8:97794703..97794865 -)
Downstram Exon
ENSMUSE00000718108 (Chr8:97794703..97794865 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GACACTCCCTCCACCTGAGA Chr8:97794770..97794789 60.24 60 TCTCAGGTGGAGGGAGTGTC Chr8:97794748..97794767 60.24 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000634992 Chr8:97808068..97808081 No primer for this exon
upstream ENSMUSE00000711057 Chr8:97808068..97808081 No primer for this exon
upstream ENSMUSE00000714574 Chr8:97805316..97805490 CACAGCCCCAAGCTAACCTA Chr8:97805359..97805378 60.26 55
upstream ENSMUSE00000721488 Chr8:97805237..97805510 AAGTAGGTGACCGCTCCTGA Chr8:97805298..97805317 59.87 55
upstream ENSMUSE00000420219 Chr8:97802140..97802227 GGACGAGTGCCAGCTAGAAA Chr8:97802169..97802188 60.54 55
upstream ENSMUSE00000720343 Chr8:97802140..97802227 GGACGAGTGCCAGCTAGAAA Chr8:97802169..97802188 60.54 55
upstream ENSMUSE00000477290 Chr8:97801656..97801776 GGAGGCCACAAACTCAACAG Chr8:97801656..97801675 60.69 55
upstream ENSMUSE00000720813 Chr8:97801656..97801776 GGAGGCCACAAACTCAACAG Chr8:97801656..97801675 60.69 55
upstream ENSMUSE00000243266 Chr8:97794703..97794865 GACACTCCCTCCACCTGAGA Chr8:97794770..97794789 60.24 60
upstream ENSMUSE00000718108 Chr8:97794703..97794865 GACACTCCCTCCACCTGAGA Chr8:97794770..97794789 60.24 60

*** Putative Vector Insertion (Chr 8: 97794702 - 97794866) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000243259 Chr8:97791548..97791655 GACAGGGCCTTGAGCTCTTC Chr8:97791583..97791602 61.45 60
downstream ENSMUSE00000716478 Chr8:97791548..97791655 GACAGGGCCTTGAGCTCTTC Chr8:97791583..97791602 61.45 60
downstream ENSMUSE00000213013 Chr8:97789854..97790011 GAGGTGACGTCAGGGTCAAT Chr8:97789855..97789874 59.97 55
downstream ENSMUSE00000720530 Chr8:97789854..97790011 GAGGTGACGTCAGGGTCAAT Chr8:97789855..97789874 59.97 55
downstream ENSMUSE00000213004 Chr8:97788288..97788443 GGGAACCGGTACATCTTCAA Chr8:97788289..97788308 59.79 50
downstream ENSMUSE00000243246 Chr8:97786989..97787197 ACGGTGATGTCCAGGAGGTA Chr8:97787010..97787029 60.39 55
downstream ENSMUSE00000213012 Chr8:97784524..97784574 CTTAAACCGGCGAGACTTCA Chr8:97784502..97784521 60.38 50
downstream ENSMUSE00000213015 Chr8:97784008..97784094 GAGGGTTGATGCCAAGTTTC Chr8:97784012..97784031 59.53 50
downstream ENSMUSE00000213011 Chr8:97783032..97783096 GCTTCCAGGCGGTTATTAAA Chr8:97783037..97783056 59.21 45
downstream ENSMUSE00000213003 Chr8:97781737..97781859 CACTCCGTCGTAAACCCAGT Chr8:97781723..97781742 60.03 55
downstream ENSMUSE00000243219 Chr8:97777962..97778103 AGTCCTCCGATGGTGATGAG Chr8:97778028..97778047 60.07 55
downstream ENSMUSE00000213017 Chr8:97777149..97777308 ACCAGGTCTTGACACGGTTC Chr8:97777160..97777179 60.01 55
downstream ENSMUSE00000213010 Chr8:97775981..97776078 GCATCTTGTCCGGAAGTTGT Chr8:97776018..97776037 60.12 50
downstream ENSMUSE00000213006 Chr8:97775805..97775888 GAAGATCATCTGCCGGTCAC Chr8:97775843..97775862 60.63 55
downstream ENSMUSE00000213008 Chr8:97772819..97772937 ACCAGTACAGCCTTCCCATC Chr8:97772833..97772852 59.02 55
downstream ENSMUSE00000213014 Chr8:97772274..97772420 TCTGAGATTCCGGGTAATGC Chr8:97772274..97772293 60.04 50
downstream ENSMUSE00000213007 Chr8:97766089..97766308 AGTGCAGCCAGTTCCTTGAG Chr8:97766104..97766123 60.59 55
downstream ENSMUSE00000711340 Chr8:97764887..97765381 GAGCTCGAGGGCATCACTAC Chr8:97764935..97764954 59.98 60
downstream ENSMUSE00000708907 Chr8:97764881..97765381 GAGCTCGAGGGCATCACTAC Chr8:97764935..97764954 59.98 60
downstream ENSMUSE00000467712 Chr8:97762950..97765381 ATGCCACCGTTTACTGAAGG Chr8:97763529..97763548 59.99 50
downstream ENSMUSE00000710516 Chr8:97762945..97765381 ATGCCACCGTTTACTGAAGG Chr8:97763529..97763548 59.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTCCACAGTACCAGCCACAA Chr8:97794852..97794872 59.74 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTCCACAGTACCAGCCACAA Chr8:97794852..97794872 59.74 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031789