Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI25661
Trapped Gene
Lass2 (ENSMUSG00000015714)
Vector Insertion
Chr 3: 95124682 - 95124863
Public Clones not available
Private Clones OST171216 (lexicon)
Severity of mutation (?) Insertion after 26% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000253057 (Chr3:95124564..95124681 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000253057 (Chr3:95124564..95124681 +)
Downstram Exon
ENSMUSE00000253053 (Chr3:95124864..95124982 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000253068 Chr3:95119189..95119267 No primer for this exon
upstream ENSMUSE00000253063 Chr3:95123984..95124157 No primer for this exon
upstream ENSMUSE00000253057 Chr3:95124564..95124681 No primer for this exon

*** Putative Vector Insertion (Chr 3: 95124682 - 95124863) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000253053 Chr3:95124864..95124982 No primer for this exon
downstream ENSMUSE00000253049 Chr3:95125112..95125169 No primer for this exon
downstream ENSMUSE00000253042 Chr3:95125258..95125308 No primer for this exon
downstream ENSMUSE00000176414 Chr3:95125497..95125589 No primer for this exon
downstream ENSMUSE00000176412 Chr3:95125753..95125881 No primer for this exon
downstream ENSMUSE00000176408 Chr3:95126049..95126155 No primer for this exon
downstream ENSMUSE00000176410 Chr3:95126242..95126395 No primer for this exon
downstream ENSMUSE00000362790 Chr3:95126571..95127488 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGATTCTGGCAGTTGCTGAG Chr3:95124697..95124717 60.14 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGATTCTGGCAGTTGCTGAG Chr3:95124697..95124717 60.14 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000015714