Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI25671
Trapped Gene
Sf3b1 (ENSMUSG00000025982)
Vector Insertion
Chr 1: 55073335 - 55073622
Public Clones not available
Private Clones OST170880 (lexicon)
Severity of mutation (?) Insertion after 8% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000154640 (Chr1:55073623..55073727 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CGTGGCGTTGCTTAATGATA Chr1:55073643..55073662 59.72 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000154640 (Chr1:55073623..55073727 -)
Downstram Exon
ENSMUSE00000154628 (Chr1:55073220..55073334 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CGTGGCGTTGCTTAATGATA Chr1:55073643..55073662 59.72 45 GCAATCTTTGGAGGACGATG Chr1:55073275..55073294 60.6 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000404773 Chr1:55084183..55084323 CAGTTCCGTCTGTGTGTTCG Chr1:55084221..55084240 60.35 55
upstream ENSMUSE00000154641 Chr1:55076078..55076244 GGCCTTGATTCCACAGGTTA Chr1:55076160..55076179 59.93 50
upstream ENSMUSE00000154640 Chr1:55073623..55073727 CGTGGCGTTGCTTAATGATA Chr1:55073643..55073662 59.72 45

*** Putative Vector Insertion (Chr 1: 55073335 - 55073622) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000154628 Chr1:55073220..55073334 GCAATCTTTGGAGGACGATG Chr1:55073275..55073294 60.6 50
downstream ENSMUSE00000154631 Chr1:55071327..55071406 No primer for this exon
downstream ENSMUSE00000154627 Chr1:55068946..55069116 AGTCTGGTCAGCGGTCTGAT Chr1:55068969..55068988 59.87 55
downstream ENSMUSE00000154647 Chr1:55064324..55064561 ACTGGAAGTTGCACCACCAT Chr1:55064345..55064364 60.43 50
downstream ENSMUSE00000154624 Chr1:55063015..55063227 GTGCTTCCACCCATTTGACT Chr1:55063061..55063080 59.97 50
downstream ENSMUSE00000154637 Chr1:55062646..55062767 GCGGTTTCGTTCATCAATTT Chr1:55062672..55062691 59.94 40
downstream ENSMUSE00000243904 Chr1:55060137..55060334 TCAGCTTTCGAGCTGGAGTT Chr1:55060258..55060277 60.28 50
downstream ENSMUSE00000243895 Chr1:55059948..55060049 No primer for this exon
downstream ENSMUSE00000243887 Chr1:55058227..55058406 AGGGGACATCAACAGAGGAA Chr1:55058298..55058317 59.51 50
downstream ENSMUSE00000154632 Chr1:55057856..55057942 CAACAGTGGCTCGATAACCA Chr1:55057894..55057913 59.72 50
downstream ENSMUSE00000243870 Chr1:55057488..55057758 GAGGCTACGACAGCAAAAGC Chr1:55057633..55057652 60.16 55
downstream ENSMUSE00000243861 Chr1:55057086..55057231 GCACTGATGGTCCGAACTTT Chr1:55057170..55057189 60.12 50
downstream ENSMUSE00000154636 Chr1:55056859..55057005 TTCAAGAAAGCAGCCAGACC Chr1:55056964..55056983 60.52 50
downstream ENSMUSE00000154644 Chr1:55056471..55056596 CCATTCTGTGTTGCCAAAAG Chr1:55056475..55056494 59.17 45
downstream ENSMUSE00000154629 Chr1:55054882..55055103 TCTGCTGCGCCTAGATTACC Chr1:55054930..55054949 60.51 55
downstream ENSMUSE00000243834 Chr1:55053856..55054038 GGTTTGACTCGTTTGCCAAG Chr1:55053955..55053974 60.67 50
downstream ENSMUSE00000243830 Chr1:55053661..55053772 ATGCTGCCCAATACTTCAGG Chr1:55053674..55053693 60.1 50
downstream ENSMUSE00000154642 Chr1:55052210..55052330 CAATGCGTCCAACAAGATCA Chr1:55052195..55052214 60.67 45
downstream ENSMUSE00000154633 Chr1:55051174..55051305 TCAAAGCAAATCCTCATCCA Chr1:55051236..55051255 59.2 40
downstream ENSMUSE00000546829 Chr1:55047147..55047419 CAAGTAAAGGCGTCACAGCA Chr1:55047144..55047163 60.05 50
downstream ENSMUSE00000154648 Chr1:55044783..55044999 TCTGCATGGTCCAATAGCAA Chr1:55044782..55044801 60.22 45
downstream ENSMUSE00000546850 Chr1:55042016..55044336 ATAGTTTGCGTGCTGCTGTG Chr1:55043713..55043732 60.08 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGATGCCTCGCAGTTATTCA Chr1:55073600..55073620 60.37 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGATGCCTCGCAGTTATTCA Chr1:55073600..55073620 60.37 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000025982