Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI25690
Trapped Gene
Map1lc3b (ENSMUSG00000031812)
Vector Insertion
Chr 8: 124117446 - 124119885
Public Clones CMHD-GT_518G1-3 (cmhd)
Private Clones OST170414 (lexicon)
Severity of mutation (?) Insertion after 26% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000521424 (Chr8:124117390..124117445 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000521424 (Chr8:124117390..124117445 +)
Downstram Exon
ENSMUSE00000487435 (Chr8:124119886..124119992 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon CTCCCCCTTGTATCGCTCTA Chr8:124119915..124119934 59.29 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000462223 Chr8:124114377..124114464 GTCCGAGAAGACCTTCAAGC Chr8:124114430..124114449 59.02 55
upstream ENSMUSE00000521424 Chr8:124117390..124117445 No primer for this exon

*** Putative Vector Insertion (Chr 8: 124117446 - 124119885) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000487435 Chr8:124119886..124119992 CTCCCCCTTGTATCGCTCTA Chr8:124119915..124119934 59.29 55
downstream ENSMUSE00000476335 Chr8:124120496..124121946 GCTTAAGCTGGGTCAGCAAC Chr8:124121285..124121304 60.02 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAGGAGCCCCCAGTAATCG Chr8:124117483..124117503 60.3 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGACCCTAACCCCATAGGAG Chr8:124117470..124117490 59.65 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031812