Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI25702
Trapped Gene
Lgr4 (ENSMUSG00000050199)
Vector Insertion
Chr 2: 109810921 - 109829861
Public Clones IST14722F1 (tigm)
Private Clones OST169723 (lexicon) OST166794 (lexicon) OST100672 (lexicon)
Severity of mutation (?) Insertion after 9% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000376695 (Chr2:109810849..109810920 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000376695 (Chr2:109810849..109810920 +)
Downstram Exon
ENSMUSE00000315583 (Chr2:109829862..109829933 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon GGTCGTTACCAGCCAGTTGT Chr2:109829884..109829903 60.03 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000686433 Chr2:109757804..109758462 CAACCAGGGTGTTTGTGAGA Chr2:109757854..109757873 59.56 50
upstream ENSMUSE00000376695 Chr2:109810849..109810920 No primer for this exon

*** Putative Vector Insertion (Chr 2: 109810921 - 109829861) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000315583 Chr2:109829862..109829933 GGTCGTTACCAGCCAGTTGT Chr2:109829884..109829903 60.03 55
downstream ENSMUSE00000315577 Chr2:109831261..109831332 CAAAGCACTCAGTCCACGAA Chr2:109831327..109831346 60.03 50
downstream ENSMUSE00000315571 Chr2:109836711..109836926 GGGGATGCTTGAGATGTTGT Chr2:109836891..109836910 59.93 50
downstream ENSMUSE00000315564 Chr2:109837750..109837821 No primer for this exon
downstream ENSMUSE00000315555 Chr2:109839563..109839631 GCCTGAGGAAATTCATCCAA Chr2:109839604..109839623 60.01 45
downstream ENSMUSE00000315550 Chr2:109840453..109840524 CTCCATCCGGGATAACAGAA Chr2:109840496..109840515 59.89 50
downstream ENSMUSE00000315544 Chr2:109840717..109840788 GCTGAGTTCCCCACAAAAGA Chr2:109840761..109840780 60.23 50
downstream ENSMUSE00000315536 Chr2:109841087..109841155 No primer for this exon
downstream ENSMUSE00000345648 Chr2:109842623..109842694 TTTTGGCACAGATCATCAGG Chr2:109842676..109842695 59.65 45
downstream ENSMUSE00000440130 Chr2:109843611..109843676 CCAATGCACGACAACCATTA Chr2:109843672..109843691 60.38 45
downstream ENSMUSE00000440122 Chr2:109844708..109844779 GGGATGTTAGGCCTTGAAAA Chr2:109844772..109844791 59.02 45
downstream ENSMUSE00000440118 Chr2:109846661..109846732 AGCTTCGCAAAAGCTCCACT Chr2:109846717..109846736 61.57 50
downstream ENSMUSE00000440113 Chr2:109847302..109847427 TCAGGCCTTCCGTAGGAAAT Chr2:109847351..109847370 60.95 50
downstream ENSMUSE00000359323 Chr2:109848242..109848357 GGTCTTGGGGGCTGTTATCT Chr2:109848339..109848358 60.33 55
downstream ENSMUSE00000315414 Chr2:109848739..109848822 No primer for this exon
downstream ENSMUSE00000476247 Chr2:109851408..109854412 AGCTGTCCGAGACAAAGGAA Chr2:109852589..109852608 59.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGCCATTGGCAGTCACTTCT Chr2:109816944..109816964 59.87 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTCATCGTGACTGGGAAAAC Chr2:109816967..109816987 58.54 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000050199