Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI25705
Trapped Gene
Epn1 (ENSMUSG00000035203)
Vector Insertion
Chr 7: 5049014 - 5049173
Public Clones not available
Private Clones OST169550 (lexicon)
Severity of mutation (?) Insertion after 88% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000386280 (Chr7:5048756..5049013 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTAATGCAGCCCTTGTGGAT Chr7:5048921..5048940 60.1 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000386280 (Chr7:5048756..5049013 +)
Downstram Exon
ENSMUSE00000637461 (Chr7:5049174..5049778 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTAATGCAGCCCTTGTGGAT Chr7:5048921..5048940 60.1 50 GACTGAGACGGAGCTGGTTC Chr7:5049263..5049282 59.99 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000637464 Chr7:5031846..5032079 CCCTGGAAGCCCGGTATAAG Chr7:5032051..5032070 62.87 60
upstream ENSMUSE00000637469 Chr7:5031895..5032079 CCCTGGAAGCCCGGTATAAG Chr7:5032051..5032070 62.87 60
upstream ENSMUSE00000637463 Chr7:5033620..5033723 No primer for this exon
upstream ENSMUSE00000637462 Chr7:5035265..5035584 TGTGAGTCGCGTCATTTCTC Chr7:5035302..5035321 59.99 50
upstream ENSMUSE00000538345 Chr7:5035332..5035584 CACTACTGGGCACAATGTCG Chr7:5035343..5035362 60.17 55
upstream ENSMUSE00000398658 Chr7:5041521..5041770 TTCCAGTATGTGGACCGTGA Chr7:5041617..5041636 59.96 50
upstream ENSMUSE00000405634 Chr7:5044443..5044567 TGGCTATGAGCAAGGAGGAG Chr7:5044539..5044558 60.49 55
upstream ENSMUSE00000447145 Chr7:5044914..5044988 CCTTAGTTTGAGCCGAGAGG Chr7:5044958..5044977 59.07 55
upstream ENSMUSE00000397347 Chr7:5045501..5045584 GAGAGCAAGAGGGAGACTGG Chr7:5045552..5045571 59.13 60
upstream ENSMUSE00000469917 Chr7:5046556..5046859 CTACAGGGCCCTCTGTTGAT Chr7:5046770..5046789 59.16 55
upstream ENSMUSE00000399788 Chr7:5047245..5047355 No primer for this exon
upstream ENSMUSE00000677241 Chr7:5047490..5047576 CTCAGACTTCGACCGACTCC Chr7:5047524..5047543 59.99 60
upstream ENSMUSE00000366755 Chr7:5047493..5047576 CTCAGACTTCGACCGACTCC Chr7:5047524..5047543 59.99 60
upstream ENSMUSE00000386280 Chr7:5048756..5049013 CTAATGCAGCCCTTGTGGAT Chr7:5048921..5048940 60.1 50

*** Putative Vector Insertion (Chr 7: 5049014 - 5049173) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000345856 Chr7:5049174..5049780 GACTGAGACGGAGCTGGTTC Chr7:5049263..5049282 59.99 60
downstream ENSMUSE00000637461 Chr7:5049174..5049778 GACTGAGACGGAGCTGGTTC Chr7:5049263..5049282 59.99 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAGTGTGGCTTGTGGGACTC Chr7:5049017..5049037 60.72 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTGTGGGACTCCTGTGTCTTT Chr7:5049026..5049047 59.61 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000035203