Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI25715
Trapped Gene
Fuca1 (ENSMUSG00000028673)
Vector Insertion
Chr 4: 135489015 - 135490604
Public Clones not available
Private Clones OST169282 (lexicon)
Severity of mutation (?) Insertion after 68% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000181219 (Chr4:135488814..135489014 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTGGGGCTATCGAAAAGACA Chr4:135488954..135488973 60.21 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000181219 (Chr4:135488814..135489014 +)
Downstram Exon
ENSMUSE00000181227 (Chr4:135490605..135490795 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTGGGGCTATCGAAAAGACA Chr4:135488954..135488973 60.21 50 CCTCCCAAACTTACCGTCTG Chr4:135490636..135490655 59.59 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000262007 Chr4:135476674..135477065 ATCAGTGGGCCGAACTCTTT Chr4:135477029..135477048 61.02 50
upstream ENSMUSE00000400130 Chr4:135478882..135479016 ACTGGAACTCGAAGGACGTG Chr4:135478947..135478966 60.3 55
upstream ENSMUSE00000181220 Chr4:135481464..135481601 ATACGCTACGGCCTCTACCA Chr4:135481468..135481487 59.75 55
upstream ENSMUSE00000181225 Chr4:135485814..135485919 ACTGGAACTCCACCAGCTTC Chr4:135485867..135485886 59.31 55
upstream ENSMUSE00000181219 Chr4:135488814..135489014 CTGGGGCTATCGAAAAGACA Chr4:135488954..135488973 60.21 50

*** Putative Vector Insertion (Chr 4: 135489015 - 135490604) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000181227 Chr4:135490605..135490795 CCTCCCAAACTTACCGTCTG Chr4:135490636..135490655 59.59 55
downstream ENSMUSE00000181221 Chr4:135492838..135492937 GGCGTAAACAGTTGCGTTTT Chr4:135492871..135492890 60.17 45
downstream ENSMUSE00000341316 Chr4:135494989..135495203 AGAGTCCACGCAAACTCCAC Chr4:135495110..135495129 60.31 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCGCCAAGGAAAATGAAATC Chr4:135488990..135489010 60.02 40 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCTTTGAGCTGCCCTCTGAC Chr4:135489045..135489065 60.68 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000028673